EMAIL THIS PAGE TO A FRIEND

ART5

ADP-ribosyltransferase 5

78 Gene Product Result for
Synonyms: ARTC5
UniProtKB ID: Q96L15, C9IYG7, Q6UX84, Q86W02
Gene ID:
Human(116969) Summary: The protein encoded by this gene belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Transcript variants with different 5' UTRs, but encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11875) ADP-ribosyltransferase 5
Rat(259167) ADP-ribosyltransferase 5
chicken(430227) ADP-ribosyltransferase 5
dog(485214) ADP-ribosyltransferase 5
cow(100336836) ADP-ribosyltransferase 5
domestic cat(101096839) ADP-ribosyltransferase 5
domestic guinea pig(100715378) ADP-ribosyltransferase 5
naked mole-rat(101722974) ADP-ribosyltransferase 5
sheep(443197) ADP-ribosyltransferase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053017 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060691 MISSION® esiRNA esiRNA human ART5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079536 Rosetta Predictions human pricing
NM_053017 Rosetta Predictions human pricing
NM_001013039 Rosetta Predictions rat pricing
NM_007491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313560 predicted 419
2 SASI_Hs02_00313561 predicted 420
3 SASI_Hs02_00313562 predicted 431
4 SASI_Hs02_00313563 predicted 526
5 SASI_Hs02_00313564 predicted 974
6 SASI_Hs02_00313565 predicted 368
7 SASI_Hs02_00313566 predicted 448
8 SASI_Hs02_00313567 predicted 867
9 SASI_Hs02_00313568 predicted 399
10 SASI_Hs02_00313569 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361839 predicted 669
2 SASI_Hs02_00361840 predicted 676
3 SASI_Hs01_00023545 predicted 689
4 SASI_Hs01_00023546 predicted 772
5 SASI_Hs01_00023548 predicted 1226
6 SASI_Hs01_00023549 predicted 615
7 SASI_Hs01_00023550 predicted 692
8 SASI_Hs01_00023551 predicted 1122
9 SASI_Hs02_00361841 predicted 647
10 SASI_Hs02_00361842 predicted 1131
11 SASI_Hs01_00023543 predicted 611
12 SASI_Hs01_00023544 predicted 437
13 SASI_Hs01_00023547 predicted 557
14 SASI_Hs01_00023552 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036386 predicted 1591
2 SASI_Rn01_00036388 predicted 1654
3 SASI_Rn01_00036389 predicted 1536
4 SASI_Rn01_00036390 predicted 1674
5 SASI_Rn01_00036391 predicted 1744
6 SASI_Rn01_00036392 predicted 1755
7 SASI_Rn01_00036393 predicted 1502
8 SASI_Rn01_00036394 predicted 1308
9 SASI_Rn01_00036395 predicted 1108
10 SASI_Rn02_00200632 predicted 884
11 SASI_Rn01_00036387 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101216 predicted 1024
2 SASI_Mm01_00101217 predicted 740
3 SASI_Mm02_00311760 predicted 1145
4 SASI_Mm01_00101218 predicted 825
5 SASI_Mm01_00101219 predicted 1256
6 SASI_Mm01_00101221 predicted 845
7 SASI_Mm02_00311761 predicted 589
8 SASI_Mm01_00101222 predicted 1230
9 SASI_Mm01_00101223 predicted 1306
10 SASI_Mm01_00101225 predicted 1222
11 SASI_Mm01_00101220 predicted 1422
12 SASI_Mm01_00101224 predicted 1487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007491
ART5 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosyltransferase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007491.1-1623s1c1
Sequence:CCGGCTTAGGACTCTTGGGAACTAACTCGAGTTAGTTCCCAAGAGTCCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-1450s1c1
Sequence:CCGGGCCACTTTAACTGCGCCTATTCTCGAGAATAGGCGCAGTTAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-1286s1c1
Sequence:CCGGCTTCAATCTAAGGACTTGTTTCTCGAGAAACAAGTCCTTAGATTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-780s1c1
Sequence:CCGGGTTCCAGATACCTTTGATGATCTCGAGATCATCAAAGGTATCTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-1213s1c1
Sequence:CCGGCTGTCCGATTAGGACAGTTTACTCGAGTAAACTGTCCTAATCGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007491
ART5 MISSION shRNA shRNA Plasmid DNA
ADP-ribosyltransferase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007491.1-1623s1c1
Sequence:CCGGCTTAGGACTCTTGGGAACTAACTCGAGTTAGTTCCCAAGAGTCCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-1450s1c1
Sequence:CCGGGCCACTTTAACTGCGCCTATTCTCGAGAATAGGCGCAGTTAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-1286s1c1
Sequence:CCGGCTTCAATCTAAGGACTTGTTTCTCGAGAAACAAGTCCTTAGATTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-780s1c1
Sequence:CCGGGTTCCAGATACCTTTGATGATCTCGAGATCATCAAAGGTATCTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-1213s1c1
Sequence:CCGGCTGTCCGATTAGGACAGTTTACTCGAGTAAACTGTCCTAATCGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007491
ART5 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosyltransferase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007491.1-1623s1c1
Sequence:CCGGCTTAGGACTCTTGGGAACTAACTCGAGTTAGTTCCCAAGAGTCCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-1450s1c1
Sequence:CCGGGCCACTTTAACTGCGCCTATTCTCGAGAATAGGCGCAGTTAAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-1286s1c1
Sequence:CCGGCTTCAATCTAAGGACTTGTTTCTCGAGAAACAAGTCCTTAGATTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-780s1c1
Sequence:CCGGGTTCCAGATACCTTTGATGATCTCGAGATCATCAAAGGTATCTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007491.1-1213s1c1
Sequence:CCGGCTGTCCGATTAGGACAGTTTACTCGAGTAAACTGTCCTAATCGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053017
ART5 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosyltransferase 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-608s1c1
Sequence:CCGGGCCCAGAATGGAATAGCCATTCTCGAGAATGGCTATTCCATTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-437s1c1
Sequence:CCGGGACACCTTTGACGATACCTATCTCGAGATAGGTATCGTCAAAGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-937s1c1
Sequence:CCGGCTTCTCTCTAACAACTTGCTTCTCGAGAAGCAAGTTGTTAGAGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-640s1c1
Sequence:CCGGCAACTCATCGAACACCTTGTACTCGAGTACAAGGTGTTCGATGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053017.3-961s21c1
Sequence:CCGGGTGGCCCACAGATTTGGTAATCTCGAGATTACCAAATCTGTGGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053017.3-1022s21c1
Sequence:CCGGTACAGGCCTTCTCTGTCTTTCCTCGAGGAAAGACAGAGAAGGCCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053017.3-788s21c1
Sequence:CCGGCCCTGCATTTCTACCTGATCCCTCGAGGGATCAGGTAGAAATGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053017
ART5 MISSION shRNA shRNA Plasmid DNA
ADP-ribosyltransferase 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-608s1c1
Sequence:CCGGGCCCAGAATGGAATAGCCATTCTCGAGAATGGCTATTCCATTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-437s1c1
Sequence:CCGGGACACCTTTGACGATACCTATCTCGAGATAGGTATCGTCAAAGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-937s1c1
Sequence:CCGGCTTCTCTCTAACAACTTGCTTCTCGAGAAGCAAGTTGTTAGAGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-640s1c1
Sequence:CCGGCAACTCATCGAACACCTTGTACTCGAGTACAAGGTGTTCGATGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053017.3-961s21c1
Sequence:CCGGGTGGCCCACAGATTTGGTAATCTCGAGATTACCAAATCTGTGGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053017.3-1022s21c1
Sequence:CCGGTACAGGCCTTCTCTGTCTTTCCTCGAGGAAAGACAGAGAAGGCCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053017.3-788s21c1
Sequence:CCGGCCCTGCATTTCTACCTGATCCCTCGAGGGATCAGGTAGAAATGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053017
ART5 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosyltransferase 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-608s1c1
Sequence:CCGGGCCCAGAATGGAATAGCCATTCTCGAGAATGGCTATTCCATTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-437s1c1
Sequence:CCGGGACACCTTTGACGATACCTATCTCGAGATAGGTATCGTCAAAGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-937s1c1
Sequence:CCGGCTTCTCTCTAACAACTTGCTTCTCGAGAAGCAAGTTGTTAGAGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053017.2-640s1c1
Sequence:CCGGCAACTCATCGAACACCTTGTACTCGAGTACAAGGTGTTCGATGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053017.3-961s21c1
Sequence:CCGGGTGGCCCACAGATTTGGTAATCTCGAGATTACCAAATCTGTGGGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053017.3-1022s21c1
Sequence:CCGGTACAGGCCTTCTCTGTCTTTCCTCGAGGAAAGACAGAGAAGGCCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053017.3-788s21c1
Sequence:CCGGCCCTGCATTTCTACCTGATCCCTCGAGGGATCAGGTAGAAATGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)