EMAIL THIS PAGE TO A FRIEND

ARVCF

armadillo repeat gene deleted in velocardiofacial syndrome

73 Gene Product Result for
UniProtKB ID: O00192, B7WNV2
Gene ID:
Human(421) Summary: Armadillo Repeat gene deleted in Velo-Cardio-Facial syndrome (ARVCF) is a member of the catenin family. This family plays an important role in the formation of adherens junction complexes, which are thought to facilitate communication between the inside and outside environments of a cell. The ARVCF gene was isolated in the search for the genetic defect responsible for the autosomal dominant Velo-Cardio-Facial syndrome (VCFS), a relatively common human disorder with phenotypic features including cleft palate, conotruncal heart defects and facial dysmorphology. The ARVCF gene encodes a protein containing two motifs, a coiled coil domain in the N-terminus and a 10 armadillo repeat sequence in the midregion. Since these sequences can facilitate protein-protein interactions ARVCF is thought to function in a protein complex. In addition, ARVCF contains a predicted nuclear-targeting sequence suggesting that it may have a function as a nuclear protein. [provided by RefSeq, Jun 2010]
Mouse(11877) armadillo repeat gene deleted in velo-cardio-facial syndrome
Rat(303798) armadillo repeat gene deleted in velo-cardio-facial syndrome
chicken(395119) armadillo repeat gene deleted in velocardiofacial syndrome
dog(486417) armadillo repeat gene deleted in velocardiofacial syndrome
Horse(100050796) armadillo repeat gene deleted in velocardiofacial syndrome
cow(517045) armadillo repeat gene deleted in velocardiofacial syndrome
domestic cat(101096767) armadillo repeat gene deleted in velocardiofacial syndrome
Domestic Rabbit(100353881) armadillo repeat gene deleted in velocardiofacial syndrome
naked mole-rat(101720743) armadillo repeat gene deleted in velocardiofacial syndrome
domestic guinea pig(100730784) armadillo repeat gene deleted in velocardiofacial syndrome
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001670 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001670 Rosetta Predictions human pricing
NM_001131013 Rosetta Predictions rat pricing
XM_221276 Rosetta Predictions rat pricing
NM_033474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195313 predicted 1634
2 SASI_Hs02_00332305 predicted 1410
3 SASI_Hs01_00195314 predicted 640
4 SASI_Hs01_00195315 predicted 1954
5 SASI_Hs01_00195316 predicted 1152
6 SASI_Hs01_00195317 predicted 2355
7 SASI_Hs01_00195318 predicted 631
8 SASI_Hs01_00195319 predicted 1553
9 SASI_Hs01_00195320 predicted 2504
10 SASI_Hs01_00195321 predicted 2222
11 SASI_Hs01_00195322 predicted 2337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256179 predicted 1635
2 SASI_Rn02_00256180 predicted 2242
3 SASI_Rn02_00256181 predicted 3200
4 SASI_Rn02_00256182 predicted 2342
5 SASI_Rn02_00256183 predicted 3172
6 SASI_Rn02_00256184 predicted 293
7 SASI_Rn02_00256185 predicted 627
8 SASI_Rn02_00256186 predicted 2257
9 SASI_Rn02_00256187 predicted 2918
10 SASI_Rn02_00256188 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174599 predicted 2808
2 SASI_Rn01_00174600 predicted 232
3 SASI_Rn01_00174601 predicted 952
4 SASI_Rn01_00174602 predicted 3128
5 SASI_Rn01_00174603 predicted 2887
6 SASI_Rn01_00174604 predicted 1070
7 SASI_Rn01_00174605 predicted 1793
8 SASI_Rn01_00174606 predicted 4307
9 SASI_Rn01_00174607 predicted 3863
10 SASI_Rn01_00174608 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337351 predicted 1625
2 SASI_Mm02_00337352 predicted 650
3 SASI_Mm02_00337353 predicted 1026
4 SASI_Mm02_00337354 predicted 2923
5 SASI_Mm02_00337355 predicted 3165
6 SASI_Mm02_00337356 predicted 3105
7 SASI_Mm02_00337357 predicted 3121
8 SASI_Mm02_00337358 predicted 1407
9 SASI_Mm02_00337359 predicted 2256
10 SASI_Mm02_00337360 predicted 1536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001670
ARVCF MISSION shRNA Bacterial Glycerol Stock
armadillo repeat gene deleted in velocardiofacial syndrome
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001670.1-3130s21c1
Sequence:CCGGTAAGCCTCAGCCCGTTGATTCCTCGAGGAATCAACGGGCTGAGGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001670.1-2172s21c1
Sequence:CCGGGTGAGATGGACCGGAACTTTGCTCGAGCAAAGTTCCGGTCCATCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001670.1-3584s1c1
Sequence:CCGGGCTGGGAAAGAACTTGGACTTCTCGAGAAGTCCAAGTTCTTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-2777s1c1
Sequence:CCGGCGTGGTACCTTGCAGAAAGATCTCGAGATCTTTCTGCAAGGTACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-1813s1c1
Sequence:CCGGGTGGACAACTGTCTTCAAGAACTCGAGTTCTTGAAGACAGTTGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-590s1c1
Sequence:CCGGGTGTCTATTGTCACATCCGAACTCGAGTTCGGATGTGACAATAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-1810s1c1
Sequence:CCGGCGAGTGGACAACTGTCTTCAACTCGAGTTGAAGACAGTTGTCCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001670
ARVCF MISSION shRNA shRNA Plasmid DNA
armadillo repeat gene deleted in velocardiofacial syndrome
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001670.1-3130s21c1
Sequence:CCGGTAAGCCTCAGCCCGTTGATTCCTCGAGGAATCAACGGGCTGAGGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001670.1-2172s21c1
Sequence:CCGGGTGAGATGGACCGGAACTTTGCTCGAGCAAAGTTCCGGTCCATCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001670.1-3584s1c1
Sequence:CCGGGCTGGGAAAGAACTTGGACTTCTCGAGAAGTCCAAGTTCTTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-2777s1c1
Sequence:CCGGCGTGGTACCTTGCAGAAAGATCTCGAGATCTTTCTGCAAGGTACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-1813s1c1
Sequence:CCGGGTGGACAACTGTCTTCAAGAACTCGAGTTCTTGAAGACAGTTGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-590s1c1
Sequence:CCGGGTGTCTATTGTCACATCCGAACTCGAGTTCGGATGTGACAATAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-1810s1c1
Sequence:CCGGCGAGTGGACAACTGTCTTCAACTCGAGTTGAAGACAGTTGTCCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001670
ARVCF MISSION shRNA Lentiviral Transduction Particles
armadillo repeat gene deleted in velocardiofacial syndrome
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001670.1-3130s21c1
Sequence:CCGGTAAGCCTCAGCCCGTTGATTCCTCGAGGAATCAACGGGCTGAGGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001670.1-2172s21c1
Sequence:CCGGGTGAGATGGACCGGAACTTTGCTCGAGCAAAGTTCCGGTCCATCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001670.1-3584s1c1
Sequence:CCGGGCTGGGAAAGAACTTGGACTTCTCGAGAAGTCCAAGTTCTTTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-2777s1c1
Sequence:CCGGCGTGGTACCTTGCAGAAAGATCTCGAGATCTTTCTGCAAGGTACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-1813s1c1
Sequence:CCGGGTGGACAACTGTCTTCAAGAACTCGAGTTCTTGAAGACAGTTGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-590s1c1
Sequence:CCGGGTGTCTATTGTCACATCCGAACTCGAGTTCGGATGTGACAATAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001670.1-1810s1c1
Sequence:CCGGCGAGTGGACAACTGTCTTCAACTCGAGTTGAAGACAGTTGTCCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033474
VALIDATED
ARVCF MISSION shRNA Bacterial Glycerol Stock
armadillo repeat gene deleted in velocardiofacial syndrome
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033474.2-1937s1c1
Sequence:CCGGAGGAAAGACACAGATAATAAGCTCGAGCTTATTATCTGTGTCTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033474.2-4105s1c1
Sequence:CCGGGGCTGACCAATATGGGCATATCTCGAGATATGCCCATATTGGTCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033474.2-1033s1c1
Sequence:CCGGATATGGCCTGGAGGATGATACCTCGAGGTATCATCCTCCAGGCCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_033474.2-1992s1c1
Sequence:CCGGTGTCCTACCACGTGCACAAAGCTCGAGCTTTGTGCACGTGGTAGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033474.2-2466s1c1
Sequence:CCGGCACTAGACCAGCGGAACAAAGCTCGAGCTTTGTTCCGCTGGTCTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-841s1c1
Sequence:CCGGGTCCCGTGATATTCCAAGCTACTCGAGTAGCTTGGAATATCACGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-2876s1c1
Sequence:CCGGCTGGTAGACAAGAGCCTTGATCTCGAGATCAAGGCTCTTGTCTACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-1416s1c1
Sequence:CCGGGCTTTGAGAACGAGGGTATTACTCGAGTAATACCCTCGTTCTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033474.2-3786s1c1
Sequence:CCGGGCCTGCTGTTTGTGACTTTAACTCGAGTTAAAGTCACAAACAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-2734s1c1
Sequence:CCGGACAGACTGTATGGAGCTACAACTCGAGTTGTAGCTCCATACAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033474
VALIDATED
ARVCF MISSION shRNA shRNA Plasmid DNA
armadillo repeat gene deleted in velocardiofacial syndrome
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033474.2-1937s1c1
Sequence:CCGGAGGAAAGACACAGATAATAAGCTCGAGCTTATTATCTGTGTCTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033474.2-4105s1c1
Sequence:CCGGGGCTGACCAATATGGGCATATCTCGAGATATGCCCATATTGGTCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033474.2-1033s1c1
Sequence:CCGGATATGGCCTGGAGGATGATACCTCGAGGTATCATCCTCCAGGCCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_033474.2-1992s1c1
Sequence:CCGGTGTCCTACCACGTGCACAAAGCTCGAGCTTTGTGCACGTGGTAGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033474.2-2466s1c1
Sequence:CCGGCACTAGACCAGCGGAACAAAGCTCGAGCTTTGTTCCGCTGGTCTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-841s1c1
Sequence:CCGGGTCCCGTGATATTCCAAGCTACTCGAGTAGCTTGGAATATCACGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-2876s1c1
Sequence:CCGGCTGGTAGACAAGAGCCTTGATCTCGAGATCAAGGCTCTTGTCTACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-1416s1c1
Sequence:CCGGGCTTTGAGAACGAGGGTATTACTCGAGTAATACCCTCGTTCTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033474.2-3786s1c1
Sequence:CCGGGCCTGCTGTTTGTGACTTTAACTCGAGTTAAAGTCACAAACAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-2734s1c1
Sequence:CCGGACAGACTGTATGGAGCTACAACTCGAGTTGTAGCTCCATACAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033474
VALIDATED
ARVCF MISSION shRNA Lentiviral Transduction Particles
armadillo repeat gene deleted in velocardiofacial syndrome
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033474.2-1937s1c1
Sequence:CCGGAGGAAAGACACAGATAATAAGCTCGAGCTTATTATCTGTGTCTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033474.2-4105s1c1
Sequence:CCGGGGCTGACCAATATGGGCATATCTCGAGATATGCCCATATTGGTCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033474.2-1033s1c1
Sequence:CCGGATATGGCCTGGAGGATGATACCTCGAGGTATCATCCTCCAGGCCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_033474.2-1992s1c1
Sequence:CCGGTGTCCTACCACGTGCACAAAGCTCGAGCTTTGTGCACGTGGTAGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033474.2-2466s1c1
Sequence:CCGGCACTAGACCAGCGGAACAAAGCTCGAGCTTTGTTCCGCTGGTCTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-841s1c1
Sequence:CCGGGTCCCGTGATATTCCAAGCTACTCGAGTAGCTTGGAATATCACGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-2876s1c1
Sequence:CCGGCTGGTAGACAAGAGCCTTGATCTCGAGATCAAGGCTCTTGTCTACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-1416s1c1
Sequence:CCGGGCTTTGAGAACGAGGGTATTACTCGAGTAATACCCTCGTTCTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033474.2-3786s1c1
Sequence:CCGGGCCTGCTGTTTGTGACTTTAACTCGAGTTAAAGTCACAAACAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033474.2-2734s1c1
Sequence:CCGGACAGACTGTATGGAGCTACAACTCGAGTTGTAGCTCCATACAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)