EMAIL THIS PAGE TO A FRIEND

ASPHD1

aspartate beta-hydroxylase domain containing 1

101 Gene Product Result for
UniProtKB ID: Q5U4P2, A0AVE3, B7ZLZ3, Q8IW63, Q8N316, Q96H00
Gene ID:
Mouse(233879) aspartate beta-hydroxylase domain containing 1
Rat(293498) aspartate beta-hydroxylase domain containing 1
naked mole-rat(101711457) aspartate beta-hydroxylase domain containing 1
domestic guinea pig(100733073) aspartate beta-hydroxylase domain containing 1
sheep(101118658) aspartate beta-hydroxylase domain containing 1
Zebrafish(557921) aspartate beta-hydroxylase domain containing 1
dog(489941) aspartate beta-hydroxylase domain containing 1
domestic cat(101098597) aspartate beta-hydroxylase domain containing 1
cow(614735) aspartate beta-hydroxylase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038641 MISSION® esiRNA esiRNA human ASPHD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181718 Rosetta Predictions human pricing
XM_001078017 Rosetta Predictions rat pricing
XM_215083 Rosetta Predictions rat pricing
NM_001039645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185368 predicted 885
2 SASI_Hs01_00185369 predicted 1076
3 SASI_Hs01_00185370 predicted 607
4 SASI_Hs01_00185371 predicted 970
5 SASI_Hs02_00370328 predicted 886
6 SASI_Hs01_00185372 predicted 1209
7 SASI_Hs01_00185373 predicted 575
8 SASI_Hs01_00185374 predicted 1221
9 SASI_Hs01_00185375 predicted 558
10 SASI_Hs01_00185376 predicted 1059
11 SASI_Hs01_00185377 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359375 predicted 714
2 SASI_Rn02_00359376 predicted 448
3 SASI_Rn02_00359377 predicted 591
4 SASI_Rn02_00359378 predicted 436
5 SASI_Rn02_00359379 predicted 1013
6 SASI_Rn02_00359380 predicted 507
7 SASI_Rn02_00359381 predicted 651
8 SASI_Rn02_00359382 predicted 327
9 SASI_Rn02_00359383 predicted 205
10 SASI_Rn02_00359384 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375787 predicted 719
2 SASI_Rn02_00375788 predicted 1012
3 SASI_Rn02_00375789 predicted 796
4 SASI_Rn02_00375790 predicted 1071
5 SASI_Rn02_00375791 predicted 888
6 SASI_Rn02_00375792 predicted 893
7 SASI_Rn02_00375793 predicted 1058
8 SASI_Rn02_00375794 predicted 822
9 SASI_Rn02_00375795 predicted 1071
10 SASI_Rn02_00375796 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054786 predicted 297
2 SASI_Mm01_00054787 predicted 210
3 SASI_Mm01_00054788 predicted 259
4 SASI_Mm01_00054789 predicted 262
5 SASI_Mm01_00054790 predicted 205
6 SASI_Mm01_00054791 predicted 252
7 SASI_Mm01_00054792 predicted 282
8 SASI_Mm01_00054793 predicted 263
9 SASI_Mm01_00054794 predicted 203
10 SASI_Mm01_00054795 predicted 212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198907
VALIDATED
ASPHD1 MISSION shRNA Bacterial Glycerol Stock
aspartate beta-hydroxylase domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1505s1c1
Sequence:CCGGCAACTGGAGAAACCGGAGTATCTCGAGATACTCCGGTTTCTCCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1528s1c1
Sequence:CCGGCCTGGACTGGATATTAAATAACTCGAGTTATTTAATATCCAGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1424s1c1
Sequence:CCGGCAAACAGATAACCAGATGCAACTCGAGTTGCATCTGGTTATCTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1420s1c1
Sequence:CCGGCAACCAAACAGATAACCAGATCTCGAGATCTGGTTATCTGTTTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198907.1-986s1c1
Sequence:CCGGCTTTATGAGTGCCAACACCTTCTCGAGAAGGTGTTGGCACTCATAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160923    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1399s1c1
Sequence:CCGGGCCTTATGTCTTCTCCTAGTACTCGAGTACTAGGAGAAGACATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198907.1-1430s1c1
Sequence:CCGGGATAACCAGATGCAACGTGAACTCGAGTTCACGTTGCATCTGGTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198907.1-212s1c1
Sequence:CCGGGAGTGGAATGTGGAAGGGAAACTCGAGTTTCCCTTCCACATTCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198907.1-985s1c1
Sequence:CCGGGCTTTATGAGTGCCAACACCTCTCGAGAGGTGTTGGCACTCATAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198907
VALIDATED
ASPHD1 MISSION shRNA shRNA Plasmid DNA
aspartate beta-hydroxylase domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1505s1c1
Sequence:CCGGCAACTGGAGAAACCGGAGTATCTCGAGATACTCCGGTTTCTCCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1528s1c1
Sequence:CCGGCCTGGACTGGATATTAAATAACTCGAGTTATTTAATATCCAGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1424s1c1
Sequence:CCGGCAAACAGATAACCAGATGCAACTCGAGTTGCATCTGGTTATCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1420s1c1
Sequence:CCGGCAACCAAACAGATAACCAGATCTCGAGATCTGGTTATCTGTTTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198907.1-986s1c1
Sequence:CCGGCTTTATGAGTGCCAACACCTTCTCGAGAAGGTGTTGGCACTCATAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160923    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1399s1c1
Sequence:CCGGGCCTTATGTCTTCTCCTAGTACTCGAGTACTAGGAGAAGACATAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198907.1-1430s1c1
Sequence:CCGGGATAACCAGATGCAACGTGAACTCGAGTTCACGTTGCATCTGGTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198907.1-212s1c1
Sequence:CCGGGAGTGGAATGTGGAAGGGAAACTCGAGTTTCCCTTCCACATTCCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198907.1-985s1c1
Sequence:CCGGGCTTTATGAGTGCCAACACCTCTCGAGAGGTGTTGGCACTCATAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198907
VALIDATED
ASPHD1 MISSION shRNA Lentiviral Transduction Particles
aspartate beta-hydroxylase domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1505s1c1
Sequence:CCGGCAACTGGAGAAACCGGAGTATCTCGAGATACTCCGGTTTCTCCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1528s1c1
Sequence:CCGGCCTGGACTGGATATTAAATAACTCGAGTTATTTAATATCCAGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1424s1c1
Sequence:CCGGCAAACAGATAACCAGATGCAACTCGAGTTGCATCTGGTTATCTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1420s1c1
Sequence:CCGGCAACCAAACAGATAACCAGATCTCGAGATCTGGTTATCTGTTTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198907.1-986s1c1
Sequence:CCGGCTTTATGAGTGCCAACACCTTCTCGAGAAGGTGTTGGCACTCATAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160923    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198907.1-1399s1c1
Sequence:CCGGGCCTTATGTCTTCTCCTAGTACTCGAGTACTAGGAGAAGACATAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198907.1-1430s1c1
Sequence:CCGGGATAACCAGATGCAACGTGAACTCGAGTTCACGTTGCATCTGGTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198907.1-212s1c1
Sequence:CCGGGAGTGGAATGTGGAAGGGAAACTCGAGTTTCCCTTCCACATTCCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198907.1-985s1c1
Sequence:CCGGGCTTTATGAGTGCCAACACCTCTCGAGAGGTGTTGGCACTCATAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039645
ASPHD1 MISSION shRNA Bacterial Glycerol Stock
aspartate beta-hydroxylase domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-173s21c1
Sequence:CCGGCACCAATGCTCGGGTTAGATGCTCGAGCATCTAACCCGAGCATTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-188s21c1
Sequence:CCGGTAGATGCCATCTGGGCCTGAACTCGAGTTCAGGCCCAGATGGCATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-335s21c1
Sequence:CCGGTCGAGTGGTCTTCATTGTGGACTCGAGTCCACAATGAAGACCACTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-294s21c1
Sequence:CCGGCTGCACACAGTGGCTCATAATCTCGAGATTATGAGCCACTGTGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-209s21c1
Sequence:CCGGGATCCCTCCTGGTTGTGAGTTCTCGAGAACTCACAACCAGGAGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039645
ASPHD1 MISSION shRNA shRNA Plasmid DNA
aspartate beta-hydroxylase domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-173s21c1
Sequence:CCGGCACCAATGCTCGGGTTAGATGCTCGAGCATCTAACCCGAGCATTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-188s21c1
Sequence:CCGGTAGATGCCATCTGGGCCTGAACTCGAGTTCAGGCCCAGATGGCATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-335s21c1
Sequence:CCGGTCGAGTGGTCTTCATTGTGGACTCGAGTCCACAATGAAGACCACTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-294s21c1
Sequence:CCGGCTGCACACAGTGGCTCATAATCTCGAGATTATGAGCCACTGTGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-209s21c1
Sequence:CCGGGATCCCTCCTGGTTGTGAGTTCTCGAGAACTCACAACCAGGAGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039645
ASPHD1 MISSION shRNA Lentiviral Transduction Particles
aspartate beta-hydroxylase domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-173s21c1
Sequence:CCGGCACCAATGCTCGGGTTAGATGCTCGAGCATCTAACCCGAGCATTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-188s21c1
Sequence:CCGGTAGATGCCATCTGGGCCTGAACTCGAGTTCAGGCCCAGATGGCATCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-335s21c1
Sequence:CCGGTCGAGTGGTCTTCATTGTGGACTCGAGTCCACAATGAAGACCACTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-294s21c1
Sequence:CCGGCTGCACACAGTGGCTCATAATCTCGAGATTATGAGCCACTGTGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039645.1-209s21c1
Sequence:CCGGGATCCCTCCTGGTTGTGAGTTCTCGAGAACTCACAACCAGGAGGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)