EMAIL THIS PAGE TO A FRIEND

ASPHD2

aspartate beta-hydroxylase domain containing 2

49 Gene Product Result for
UniProtKB ID: Q6ICH7, B2RCH3, Q7L0W3, Q9NSN3
Gene ID:
Mouse(72898) aspartate beta-hydroxylase domain containing 2
Rat(364948) aspartate beta-hydroxylase domain containing 2
Zebrafish(569819) aspartate beta-hydroxylase domain containing 2
cow(541223) aspartate beta-hydroxylase domain containing 2
Horse(100065200) aspartate beta-hydroxylase domain containing 2
domestic cat(101083717) aspartate beta-hydroxylase domain containing 2
dog(612994) aspartate beta-hydroxylase domain containing 2
chicken(425447) aspartate beta-hydroxylase domain containing 2
sheep(101118136) aspartate beta-hydroxylase domain containing 2
Domestic Rabbit(100354075) aspartate beta-hydroxylase domain containing 2
domestic guinea pig(100722206) aspartate beta-hydroxylase domain containing 2
naked mole-rat(101713906) aspartate beta-hydroxylase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020437 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020437 Rosetta Predictions human pricing
NM_001009716 Rosetta Predictions rat pricing
NM_028386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074433 predicted 729
2 SASI_Hs02_00353458 predicted 1077
3 SASI_Hs01_00074434 predicted 1145
4 SASI_Hs02_00353459 predicted 570
5 SASI_Hs01_00074435 predicted 1241
6 SASI_Hs01_00074436 predicted 775
7 SASI_Hs01_00074437 predicted 900
8 SASI_Hs01_00074438 predicted 1442
9 SASI_Hs01_00074440 predicted 1405
10 SASI_Hs01_00074441 predicted 715
11 SASI_Hs01_00074439 predicted 543
12 SASI_Hs01_00074442 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078100 predicted 826
2 SASI_Rn01_00078101 predicted 1602
3 SASI_Rn01_00078102 predicted 1238
4 SASI_Rn01_00078103 predicted 1416
5 SASI_Rn01_00078104 predicted 748
6 SASI_Rn01_00078105 predicted 1601
7 SASI_Rn01_00078107 predicted 1070
8 SASI_Rn02_00199782 predicted 671
9 SASI_Rn01_00078108 predicted 1237
10 SASI_Rn01_00078109 predicted 869
11 SASI_Rn01_00078106 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333761 predicted 523
2 SASI_Mm01_00029781 predicted 291
3 SASI_Mm01_00029782 predicted 782
4 SASI_Mm01_00029783 predicted 811
5 SASI_Mm01_00029784 predicted 843
6 SASI_Mm01_00029785 predicted 1039
7 SASI_Mm01_00029786 predicted 1300
8 SASI_Mm01_00029788 predicted 566
9 SASI_Mm01_00029789 predicted 944
10 SASI_Mm02_00333762 predicted 1040
11 SASI_Mm01_00029780 predicted 943
12 SASI_Mm01_00029787 predicted 813
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020437
ASPHD2 MISSION shRNA Bacterial Glycerol Stock
aspartate beta-hydroxylase domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020437.4-1862s21c1
Sequence:CCGGGAGTAACTAAATGGTTATTTGCTCGAGCAAATAACCATTTAGTTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020437.4-1262s21c1
Sequence:CCGGATCCGCATCCGATGCCATTTACTCGAGTAAATGGCATCGGATGCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020437.4-1903s21c1
Sequence:CCGGACTTCTTGTGGTCATCTTAAACTCGAGTTTAAGATGACCACAAGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020437.3-922s1c1
Sequence:CCGGGCACAGAAACATGATGTGGAACTCGAGTTCCACATCATGTTTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020437.3-1591s1c1
Sequence:CCGGCCTCAGCGGAAAGCTCTTATTCTCGAGAATAAGAGCTTTCCGCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020437.3-1206s1c1
Sequence:CCGGGACTGTGATAACGGAGCACTACTCGAGTAGTGCTCCGTTATCACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020437.3-1644s1c1
Sequence:CCGGCCTTGGTTATTGTAAATGGAACTCGAGTTCCATTTACAATAACCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020437.3-931s1c1
Sequence:CCGGCATGATGTGGAAGTGCTGGAACTCGAGTTCCAGCACTTCCACATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020437
ASPHD2 MISSION shRNA shRNA Plasmid DNA
aspartate beta-hydroxylase domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020437.4-1862s21c1
Sequence:CCGGGAGTAACTAAATGGTTATTTGCTCGAGCAAATAACCATTTAGTTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020437.4-1262s21c1
Sequence:CCGGATCCGCATCCGATGCCATTTACTCGAGTAAATGGCATCGGATGCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020437.4-1903s21c1
Sequence:CCGGACTTCTTGTGGTCATCTTAAACTCGAGTTTAAGATGACCACAAGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020437.3-922s1c1
Sequence:CCGGGCACAGAAACATGATGTGGAACTCGAGTTCCACATCATGTTTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020437.3-1591s1c1
Sequence:CCGGCCTCAGCGGAAAGCTCTTATTCTCGAGAATAAGAGCTTTCCGCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020437.3-1206s1c1
Sequence:CCGGGACTGTGATAACGGAGCACTACTCGAGTAGTGCTCCGTTATCACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020437.3-1644s1c1
Sequence:CCGGCCTTGGTTATTGTAAATGGAACTCGAGTTCCATTTACAATAACCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020437.3-931s1c1
Sequence:CCGGCATGATGTGGAAGTGCTGGAACTCGAGTTCCAGCACTTCCACATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020437
ASPHD2 MISSION shRNA Lentiviral Transduction Particles
aspartate beta-hydroxylase domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020437.4-1862s21c1
Sequence:CCGGGAGTAACTAAATGGTTATTTGCTCGAGCAAATAACCATTTAGTTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020437.4-1262s21c1
Sequence:CCGGATCCGCATCCGATGCCATTTACTCGAGTAAATGGCATCGGATGCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020437.4-1903s21c1
Sequence:CCGGACTTCTTGTGGTCATCTTAAACTCGAGTTTAAGATGACCACAAGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020437.3-922s1c1
Sequence:CCGGGCACAGAAACATGATGTGGAACTCGAGTTCCACATCATGTTTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020437.3-1591s1c1
Sequence:CCGGCCTCAGCGGAAAGCTCTTATTCTCGAGAATAAGAGCTTTCCGCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020437.3-1206s1c1
Sequence:CCGGGACTGTGATAACGGAGCACTACTCGAGTAGTGCTCCGTTATCACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020437.3-1644s1c1
Sequence:CCGGCCTTGGTTATTGTAAATGGAACTCGAGTTCCATTTACAATAACCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020437.3-931s1c1
Sequence:CCGGCATGATGTGGAAGTGCTGGAACTCGAGTTCCAGCACTTCCACATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028386
ASPHD2 MISSION shRNA Bacterial Glycerol Stock
aspartate beta-hydroxylase domain containing 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-371s1c1
Sequence:CCGGGCTCATCCTGTTTGTGTGGTACTCGAGTACCACACAAACAGGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028386.1-849s1c1
Sequence:CCGGGAGTGGTTCACCTTTGACTTTCTCGAGAAAGTCAAAGGTGAACCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-1121s1c1
Sequence:CCGGCCGATGCTTACTCTTTGATGACTCGAGTCATCAAAGAGTAAGCATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-1254s1c1
Sequence:CCGGGATTTCATCTTTGCTCCGGGACTCGAGTCCCGGAGCAAAGATGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028386.1-1398s1c1
Sequence:CCGGCTTTCCTTTGGTTACTGGGAACTCGAGTTCCCAGTAACCAAAGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-946s1c1
Sequence:CCGGCCTGTATTGGGAACAATGTTTCTCGAGAAACATTGTTCCCAATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028386
ASPHD2 MISSION shRNA shRNA Plasmid DNA
aspartate beta-hydroxylase domain containing 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-371s1c1
Sequence:CCGGGCTCATCCTGTTTGTGTGGTACTCGAGTACCACACAAACAGGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028386.1-849s1c1
Sequence:CCGGGAGTGGTTCACCTTTGACTTTCTCGAGAAAGTCAAAGGTGAACCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-1121s1c1
Sequence:CCGGCCGATGCTTACTCTTTGATGACTCGAGTCATCAAAGAGTAAGCATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-1254s1c1
Sequence:CCGGGATTTCATCTTTGCTCCGGGACTCGAGTCCCGGAGCAAAGATGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028386.1-1398s1c1
Sequence:CCGGCTTTCCTTTGGTTACTGGGAACTCGAGTTCCCAGTAACCAAAGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-946s1c1
Sequence:CCGGCCTGTATTGGGAACAATGTTTCTCGAGAAACATTGTTCCCAATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028386
ASPHD2 MISSION shRNA Lentiviral Transduction Particles
aspartate beta-hydroxylase domain containing 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-371s1c1
Sequence:CCGGGCTCATCCTGTTTGTGTGGTACTCGAGTACCACACAAACAGGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028386.1-849s1c1
Sequence:CCGGGAGTGGTTCACCTTTGACTTTCTCGAGAAAGTCAAAGGTGAACCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-1121s1c1
Sequence:CCGGCCGATGCTTACTCTTTGATGACTCGAGTCATCAAAGAGTAAGCATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-1254s1c1
Sequence:CCGGGATTTCATCTTTGCTCCGGGACTCGAGTCCCGGAGCAAAGATGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028386.1-1398s1c1
Sequence:CCGGCTTTCCTTTGGTTACTGGGAACTCGAGTTCCCAGTAACCAAAGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028386.1-946s1c1
Sequence:CCGGCCTGTATTGGGAACAATGTTTCTCGAGAAACATTGTTCCCAATACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)