EMAIL THIS PAGE TO A FRIEND

ASPSCR1

alveolar soft part sarcoma chromosome region, candidate 1

56 Gene Product Result for
Synonyms: ASPCR1 ASPL ASPS RCC17 TUG UBXD9 UBXN9
UniProtKB ID: Q9BZE9, A8K3K9, Q7Z6N7, Q8WV59, Q96LS5, Q96M40
Gene ID:
Human(79058) Summary: The protein encoded by this gene contains a UBX domain and interacts with glucose transporter type 4 (GLUT4). This protein is a tether, which sequesters the GLUT4 in intracellular vesicles in muscle and fat cells in the absence of insulin, and redistributes the GLUT4 to the plasma membrane within minutes of insulin stimulation. Translocation t(X;17)(p11;q25) of this gene with transcription factor TFE3 gene results in a ASPSCR1-TFE3 fusion protein in alveolar soft part sarcoma and in renal cell carcinomas. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2011]
Mouse(68938) alveolar soft part sarcoma chromosome region, candidate 1 (human)
Rat(691026) alveolar soft part sarcoma chromosome region, candidate 1 (human)
sheep(101107539) alveolar soft part sarcoma chromosome region, candidate 1
domestic guinea pig(100714921) alveolar soft part sarcoma chromosome region, candidate 1
naked mole-rat(101722623) alveolar soft part sarcoma chromosome region, candidate 1
Zebrafish(550237) alveolar soft part sarcoma chromosome region, candidate 1
cow(515670) alveolar soft part sarcoma chromosome region, candidate 1
domestic cat(101101178) alveolar soft part sarcoma chromosome region, candidate 1
dog(475925) alveolar soft part sarcoma chromosome region, candidate 1
chicken(417384) alveolar soft part sarcoma chromosome region, candidate 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024083 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024083 Rosetta Predictions human pricing
XM_001076577 Rosetta Predictions rat pricing
NM_026877 Rosetta Predictions mouse pricing
NM_198223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101605 predicted 353
2 SASI_Hs01_00101606 predicted 516
3 SASI_Hs01_00101607 predicted 237
4 SASI_Hs01_00101608 predicted 236
5 SASI_Hs01_00101609 predicted 590
6 SASI_Hs01_00101610 predicted 1290
7 SASI_Hs01_00101611 predicted 1431
8 SASI_Hs01_00101612 predicted 599
9 SASI_Hs01_00101613 predicted 502
10 SASI_Hs01_00101614 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353781 predicted 715
2 SASI_Rn02_00353782 predicted 526
3 SASI_Rn02_00353783 predicted 887
4 SASI_Rn02_00353784 predicted 877
5 SASI_Rn02_00353785 predicted 948
6 SASI_Rn02_00353786 predicted 701
7 SASI_Rn02_00353787 predicted 1055
8 SASI_Rn02_00353788 predicted 926
9 SASI_Rn02_00353789 predicted 475
10 SASI_Rn02_00353790 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039288 predicted 537
2 SASI_Mm01_00039289 predicted 1043
3 SASI_Mm01_00039290 predicted 559
4 SASI_Mm01_00039291 predicted 1554
5 SASI_Mm01_00039292 predicted 1268
6 SASI_Mm01_00039293 predicted 1225
7 SASI_Mm01_00039294 predicted 477
8 SASI_Mm01_00039295 predicted 571
9 SASI_Mm01_00039296 predicted 1177
10 SASI_Mm01_00039297 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094332 predicted 355
2 SASI_Mm01_00094333 predicted 869
3 SASI_Mm01_00094334 predicted 380
4 SASI_Mm01_00094335 predicted 1371
5 SASI_Mm01_00094336 predicted 1087
6 SASI_Mm01_00094337 predicted 1046
7 SASI_Mm01_00094338 predicted 294
8 SASI_Mm01_00094339 predicted 390
9 SASI_Mm01_00094340 predicted 996
10 SASI_Mm01_00094341 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024083
VALIDATED
ASPSCR1 MISSION shRNA Bacterial Glycerol Stock
alveolar soft part sarcoma chromosome region, candidate 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022414    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1812s1c1
Sequence:CCGGCCAGCAGGAATAAAGACTTGTCTCGAGACAAGTCTTTATTCCTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1622s1c1
Sequence:CCGGCCTGCACCTAAGTCTGAGCCACTCGAGTGGCTCAGACTTAGGTGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1117s1c1
Sequence:CCGGGCCTGATGAGTTCTTTGAGCTCTCGAGAGCTCAAAGAACTCATCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024083.2-237s1c1
Sequence:CCGGCCTGTGAATATGATCTGAAGTCTCGAGACTTCAGATCATATTCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1112s1c1
Sequence:CCGGGAGCTGCCTGATGAGTTCTTTCTCGAGAAAGAACTCATCAGGCAGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024083.2-278s21c1
Sequence:CCGGCTTTCTCTCCAGTGGAGATTTCTCGAGAAATCTCCACTGGAGAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_024083.2-1222s21c1
Sequence:CCGGCTTCAGGGAGGCGCAGATAAACTCGAGTTTATCTGCGCCTCCCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024083.2-401s21c1
Sequence:CCGGTCGAGGTTGCAGGACTCTTTCCTCGAGGAAAGAGTCCTGCAACCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024083.2-1812s21c1
Sequence:CCGGCCAGCAGGAATAAAGACTTGTCTCGAGACAAGTCTTTATTCCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024083
VALIDATED
ASPSCR1 MISSION shRNA shRNA Plasmid DNA
alveolar soft part sarcoma chromosome region, candidate 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022414    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1812s1c1
Sequence:CCGGCCAGCAGGAATAAAGACTTGTCTCGAGACAAGTCTTTATTCCTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1622s1c1
Sequence:CCGGCCTGCACCTAAGTCTGAGCCACTCGAGTGGCTCAGACTTAGGTGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1117s1c1
Sequence:CCGGGCCTGATGAGTTCTTTGAGCTCTCGAGAGCTCAAAGAACTCATCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024083.2-237s1c1
Sequence:CCGGCCTGTGAATATGATCTGAAGTCTCGAGACTTCAGATCATATTCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1112s1c1
Sequence:CCGGGAGCTGCCTGATGAGTTCTTTCTCGAGAAAGAACTCATCAGGCAGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024083.2-278s21c1
Sequence:CCGGCTTTCTCTCCAGTGGAGATTTCTCGAGAAATCTCCACTGGAGAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_024083.2-1222s21c1
Sequence:CCGGCTTCAGGGAGGCGCAGATAAACTCGAGTTTATCTGCGCCTCCCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024083.2-401s21c1
Sequence:CCGGTCGAGGTTGCAGGACTCTTTCCTCGAGGAAAGAGTCCTGCAACCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024083.2-1812s21c1
Sequence:CCGGCCAGCAGGAATAAAGACTTGTCTCGAGACAAGTCTTTATTCCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024083
VALIDATED
ASPSCR1 MISSION shRNA Lentiviral Transduction Particles
alveolar soft part sarcoma chromosome region, candidate 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022414    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1812s1c1
Sequence:CCGGCCAGCAGGAATAAAGACTTGTCTCGAGACAAGTCTTTATTCCTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1622s1c1
Sequence:CCGGCCTGCACCTAAGTCTGAGCCACTCGAGTGGCTCAGACTTAGGTGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1117s1c1
Sequence:CCGGGCCTGATGAGTTCTTTGAGCTCTCGAGAGCTCAAAGAACTCATCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024083.2-237s1c1
Sequence:CCGGCCTGTGAATATGATCTGAAGTCTCGAGACTTCAGATCATATTCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024083.2-1112s1c1
Sequence:CCGGGAGCTGCCTGATGAGTTCTTTCTCGAGAAAGAACTCATCAGGCAGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024083.2-278s21c1
Sequence:CCGGCTTTCTCTCCAGTGGAGATTTCTCGAGAAATCTCCACTGGAGAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_024083.2-1222s21c1
Sequence:CCGGCTTCAGGGAGGCGCAGATAAACTCGAGTTTATCTGCGCCTCCCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024083.2-401s21c1
Sequence:CCGGTCGAGGTTGCAGGACTCTTTCCTCGAGGAAAGAGTCCTGCAACCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024083.2-1812s21c1
Sequence:CCGGCCAGCAGGAATAAAGACTTGTCTCGAGACAAGTCTTTATTCCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026877
VALIDATED
ASPSCR1 MISSION shRNA Bacterial Glycerol Stock
alveolar soft part sarcoma chromosome region, candidate 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026877.1-491s1c1
Sequence:CCGGGCCTTACAGAACACAACCCTTCTCGAGAAGGGTTGTGTTCTGTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026877.1-1169s1c1
Sequence:CCGGCAGATGAAGGAGAAACTGGAACTCGAGTTCCAGTTTCTCCTTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026877.1-650s1c1
Sequence:CCGGGCATCCAGTAGCACATTGCTTCTCGAGAAGCAATGTGCTACTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026877.1-304s1c1
Sequence:CCGGGCCTGAGAACATAGTTCGCATCTCGAGATGCGAACTATGTTCTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026877.1-756s1c1
Sequence:CCGGCCAAACCAACGGATGCTCAAACTCGAGTTTGAGCATCCGTTGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026877.1-539s1c1
Sequence:CCGGGCCACCATCAGGTTTGTCATACTCGAGTATGACAAACCTGATGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-539s21c1
Sequence:CCGGGCCACCATCAGGTTTGTCATACTCGAGTATGACAAACCTGATGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-243s21c1
Sequence:CCGGTTGCCAACCTGCCTAACAATGCTCGAGCATTGTTAGGCAGGTTGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-304s21c1
Sequence:CCGGGCCTGAGAACATAGTTCGCATCTCGAGATGCGAACTATGTTCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-650s21c1
Sequence:CCGGGCATCCAGTAGCACATTGCTTCTCGAGAAGCAATGTGCTACTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-873s21c1
Sequence:CCGGTAACATCACCTTCGGCCAATTCTCGAGAATTGGCCGAAGGTGATGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026877
VALIDATED
ASPSCR1 MISSION shRNA shRNA Plasmid DNA
alveolar soft part sarcoma chromosome region, candidate 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026877.1-491s1c1
Sequence:CCGGGCCTTACAGAACACAACCCTTCTCGAGAAGGGTTGTGTTCTGTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026877.1-1169s1c1
Sequence:CCGGCAGATGAAGGAGAAACTGGAACTCGAGTTCCAGTTTCTCCTTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026877.1-650s1c1
Sequence:CCGGGCATCCAGTAGCACATTGCTTCTCGAGAAGCAATGTGCTACTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026877.1-304s1c1
Sequence:CCGGGCCTGAGAACATAGTTCGCATCTCGAGATGCGAACTATGTTCTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026877.1-756s1c1
Sequence:CCGGCCAAACCAACGGATGCTCAAACTCGAGTTTGAGCATCCGTTGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026877.1-539s1c1
Sequence:CCGGGCCACCATCAGGTTTGTCATACTCGAGTATGACAAACCTGATGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-539s21c1
Sequence:CCGGGCCACCATCAGGTTTGTCATACTCGAGTATGACAAACCTGATGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-243s21c1
Sequence:CCGGTTGCCAACCTGCCTAACAATGCTCGAGCATTGTTAGGCAGGTTGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-304s21c1
Sequence:CCGGGCCTGAGAACATAGTTCGCATCTCGAGATGCGAACTATGTTCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-650s21c1
Sequence:CCGGGCATCCAGTAGCACATTGCTTCTCGAGAAGCAATGTGCTACTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-873s21c1
Sequence:CCGGTAACATCACCTTCGGCCAATTCTCGAGAATTGGCCGAAGGTGATGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026877
VALIDATED
ASPSCR1 MISSION shRNA Lentiviral Transduction Particles
alveolar soft part sarcoma chromosome region, candidate 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026877.1-491s1c1
Sequence:CCGGGCCTTACAGAACACAACCCTTCTCGAGAAGGGTTGTGTTCTGTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026877.1-1169s1c1
Sequence:CCGGCAGATGAAGGAGAAACTGGAACTCGAGTTCCAGTTTCTCCTTCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026877.1-650s1c1
Sequence:CCGGGCATCCAGTAGCACATTGCTTCTCGAGAAGCAATGTGCTACTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026877.1-304s1c1
Sequence:CCGGGCCTGAGAACATAGTTCGCATCTCGAGATGCGAACTATGTTCTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026877.1-756s1c1
Sequence:CCGGCCAAACCAACGGATGCTCAAACTCGAGTTTGAGCATCCGTTGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026877.1-539s1c1
Sequence:CCGGGCCACCATCAGGTTTGTCATACTCGAGTATGACAAACCTGATGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-539s21c1
Sequence:CCGGGCCACCATCAGGTTTGTCATACTCGAGTATGACAAACCTGATGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-243s21c1
Sequence:CCGGTTGCCAACCTGCCTAACAATGCTCGAGCATTGTTAGGCAGGTTGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-304s21c1
Sequence:CCGGGCCTGAGAACATAGTTCGCATCTCGAGATGCGAACTATGTTCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-650s21c1
Sequence:CCGGGCATCCAGTAGCACATTGCTTCTCGAGAAGCAATGTGCTACTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026877.1-873s21c1
Sequence:CCGGTAACATCACCTTCGGCCAATTCTCGAGAATTGGCCGAAGGTGATGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)