EMAIL THIS PAGE TO A FRIEND

ASUN

asunder spermatogenesis regulator

86 Gene Product Result for
Synonyms: C12orf11 GCT1 Mat89Bb NET48 SPATA30
UniProtKB ID: Q9NVM9, Q86WE2, Q96HM2, Q9BTX2, Q9NTB6, Q9NVM5
Gene ID:
Mouse(71177) asunder, spermatogenesis regulator
Rat(690728) asunder, spermatogenesis regulator
naked mole-rat(101714718) asunder spermatogenesis regulator
domestic guinea pig(100724102) asunder spermatogenesis regulator
sheep(101112801) asunder, spermatogenesis regulator homolog (Drosphila)
Zebrafish(334292) asunder, spermatogenesis regulator homolog (Drosphila)
cow(541109) asunder, spermatogenesis regulator homolog (Drosphila)
domestic cat(101080549) asunder, spermatogenesis regulator homolog (Drosphila)
dog(486627) asunder, spermatogenesis regulator homolog (Drosphila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018164 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018164 Rosetta Predictions human pricing
NM_001109608 Rosetta Predictions rat pricing
NM_138757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134940 predicted 1347
2 SASI_Hs01_00134939 predicted 1911
3 SASI_Hs01_00134941 predicted 2664
4 SASI_Hs02_00351411 predicted 1626
5 SASI_Hs01_00134942 predicted 949
6 SASI_Hs01_00134943 predicted 887
7 SASI_Hs01_00134945 predicted 1033
8 SASI_Hs02_00351412 predicted 2061
9 SASI_Hs02_00351413 predicted 2179
10 SASI_Hs02_00351414 predicted 2350
11 SASI_Hs01_00134944 predicted 1173
12 SASI_Hs01_00134946 predicted 2331
13 SASI_Hs01_00134947 predicted 759
14 SASI_Hs01_00134948 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250047 predicted 1076
2 SASI_Rn02_00250048 predicted 886
3 SASI_Rn02_00250049 predicted 1481
4 SASI_Rn02_00250050 predicted 522
5 SASI_Rn02_00250051 predicted 1886
6 SASI_Rn02_00250052 predicted 773
7 SASI_Rn02_00250053 predicted 2508
8 SASI_Rn02_00250054 predicted 1813
9 SASI_Rn02_00250055 predicted 2480
10 SASI_Rn02_00250056 predicted 2049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172459 predicted 1143
2 SASI_Mm01_00172462 predicted 1039
3 SASI_Mm01_00172463 predicted 1947
4 SASI_Mm02_00339816 predicted 590
5 SASI_Mm02_00339817 predicted 1361
6 SASI_Mm02_00339818 predicted 1741
7 SASI_Mm01_00172464 predicted 844
8 SASI_Mm02_00339819 predicted 1566
9 SASI_Mm02_00339820 predicted 1683
10 SASI_Mm02_00339821 predicted 1725
11 SASI_Mm01_00172460 predicted 2044
12 SASI_Mm01_00172461 predicted 2096
13 SASI_Mm01_00172465 predicted 2275
14 SASI_Mm01_00172466 predicted 532
15 SASI_Mm01_00172467 predicted 2484
16 SASI_Mm01_00172468 predicted 2728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138757
VALIDATED
ASUN MISSION shRNA Bacterial Glycerol Stock
asunder spermatogenesis regulator
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-2497s1c1
Sequence:CCGGGCGTTTGAACTCTGTCAATAACTCGAGTTATTGACAGAGTTCAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-2273s1c1
Sequence:CCGGGCAGACAGATTGAAAGGGATTCTCGAGAATCCCTTTCAATCTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138757.1-1101s1c1
Sequence:CCGGCCTACCCAGTTGGTGAAGATACTCGAGTATCTTCACCAACTGGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-1523s1c1
Sequence:CCGGCTTACTAATTTCCTCCTCAATCTCGAGATTGAGGAGGAAATTAGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-2750s1c1
Sequence:CCGGGCAAGATTGTATAGCTATGTTCTCGAGAACATAGCTATACAATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138757.2-1172s21c1
Sequence:CCGGCCTACCCAGTTGGTGAAGATACTCGAGTATCTTCACCAACTGGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138757.2-2821s21c1
Sequence:CCGGGCAAGATTGTATAGCTATGTTCTCGAGAACATAGCTATACAATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138757.2-2344s21c1
Sequence:CCGGGCAGACAGATTGAAAGGGATTCTCGAGAATCCCTTTCAATCTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138757.2-2568s21c1
Sequence:CCGGGCGTTTGAACTCTGTCAATAACTCGAGTTATTGACAGAGTTCAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138757
VALIDATED
ASUN MISSION shRNA shRNA Plasmid DNA
asunder spermatogenesis regulator
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-2497s1c1
Sequence:CCGGGCGTTTGAACTCTGTCAATAACTCGAGTTATTGACAGAGTTCAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-2273s1c1
Sequence:CCGGGCAGACAGATTGAAAGGGATTCTCGAGAATCCCTTTCAATCTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138757.1-1101s1c1
Sequence:CCGGCCTACCCAGTTGGTGAAGATACTCGAGTATCTTCACCAACTGGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-1523s1c1
Sequence:CCGGCTTACTAATTTCCTCCTCAATCTCGAGATTGAGGAGGAAATTAGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-2750s1c1
Sequence:CCGGGCAAGATTGTATAGCTATGTTCTCGAGAACATAGCTATACAATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138757.2-1172s21c1
Sequence:CCGGCCTACCCAGTTGGTGAAGATACTCGAGTATCTTCACCAACTGGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138757.2-2821s21c1
Sequence:CCGGGCAAGATTGTATAGCTATGTTCTCGAGAACATAGCTATACAATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138757.2-2344s21c1
Sequence:CCGGGCAGACAGATTGAAAGGGATTCTCGAGAATCCCTTTCAATCTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138757.2-2568s21c1
Sequence:CCGGGCGTTTGAACTCTGTCAATAACTCGAGTTATTGACAGAGTTCAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138757
VALIDATED
ASUN MISSION shRNA Lentiviral Transduction Particles
asunder spermatogenesis regulator
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-2497s1c1
Sequence:CCGGGCGTTTGAACTCTGTCAATAACTCGAGTTATTGACAGAGTTCAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-2273s1c1
Sequence:CCGGGCAGACAGATTGAAAGGGATTCTCGAGAATCCCTTTCAATCTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138757.1-1101s1c1
Sequence:CCGGCCTACCCAGTTGGTGAAGATACTCGAGTATCTTCACCAACTGGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-1523s1c1
Sequence:CCGGCTTACTAATTTCCTCCTCAATCTCGAGATTGAGGAGGAAATTAGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138757.1-2750s1c1
Sequence:CCGGGCAAGATTGTATAGCTATGTTCTCGAGAACATAGCTATACAATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138757.2-1172s21c1
Sequence:CCGGCCTACCCAGTTGGTGAAGATACTCGAGTATCTTCACCAACTGGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138757.2-2821s21c1
Sequence:CCGGGCAAGATTGTATAGCTATGTTCTCGAGAACATAGCTATACAATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138757.2-2344s21c1
Sequence:CCGGGCAGACAGATTGAAAGGGATTCTCGAGAATCCCTTTCAATCTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138757.2-2568s21c1
Sequence:CCGGGCGTTTGAACTCTGTCAATAACTCGAGTTATTGACAGAGTTCAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018164
VALIDATED
ASUN MISSION shRNA Bacterial Glycerol Stock
asunder spermatogenesis regulator
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-1730s1c1
Sequence:CCGGCCTCTACCTATTTCCACAGTTCTCGAGAACTGTGGAAATAGGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-2325s1c1
Sequence:CCGGGAGTGACTTGAAGAACTAAATCTCGAGATTTAGTTCTTCAAGTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-1790s1c1
Sequence:CCGGCGTATCATGTGGAATGAATTACTCGAGTAATTCATTCCACATGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-1295s1c1
Sequence:CCGGCCACGAAAGTCAGGTTCTAAACTCGAGTTTAGAACCTGACTTTCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-2149s1c1
Sequence:CCGGGCCAGTGTCGTTATTATCCTTCTCGAGAAGGATAATAACGACACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018164.2-1256s21c1
Sequence:CCGGGACGGCATCTTGCTACCAAATCTCGAGATTTGGTAGCAAGATGCCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018164.2-2730s21c1
Sequence:CCGGACAGCAAGATGGTATAGTTATCTCGAGATAACTATACCATCTTGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018164
VALIDATED
ASUN MISSION shRNA shRNA Plasmid DNA
asunder spermatogenesis regulator
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-1730s1c1
Sequence:CCGGCCTCTACCTATTTCCACAGTTCTCGAGAACTGTGGAAATAGGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-2325s1c1
Sequence:CCGGGAGTGACTTGAAGAACTAAATCTCGAGATTTAGTTCTTCAAGTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-1790s1c1
Sequence:CCGGCGTATCATGTGGAATGAATTACTCGAGTAATTCATTCCACATGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-1295s1c1
Sequence:CCGGCCACGAAAGTCAGGTTCTAAACTCGAGTTTAGAACCTGACTTTCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-2149s1c1
Sequence:CCGGGCCAGTGTCGTTATTATCCTTCTCGAGAAGGATAATAACGACACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018164.2-1256s21c1
Sequence:CCGGGACGGCATCTTGCTACCAAATCTCGAGATTTGGTAGCAAGATGCCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018164.2-2730s21c1
Sequence:CCGGACAGCAAGATGGTATAGTTATCTCGAGATAACTATACCATCTTGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018164
VALIDATED
ASUN MISSION shRNA Lentiviral Transduction Particles
asunder spermatogenesis regulator
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-1730s1c1
Sequence:CCGGCCTCTACCTATTTCCACAGTTCTCGAGAACTGTGGAAATAGGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-2325s1c1
Sequence:CCGGGAGTGACTTGAAGAACTAAATCTCGAGATTTAGTTCTTCAAGTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-1790s1c1
Sequence:CCGGCGTATCATGTGGAATGAATTACTCGAGTAATTCATTCCACATGATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-1295s1c1
Sequence:CCGGCCACGAAAGTCAGGTTCTAAACTCGAGTTTAGAACCTGACTTTCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018164.1-2149s1c1
Sequence:CCGGGCCAGTGTCGTTATTATCCTTCTCGAGAAGGATAATAACGACACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018164.2-1256s21c1
Sequence:CCGGGACGGCATCTTGCTACCAAATCTCGAGATTTGGTAGCAAGATGCCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018164.2-2730s21c1
Sequence:CCGGACAGCAAGATGGTATAGTTATCTCGAGATAACTATACCATCTTGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)