EMAIL THIS PAGE TO A FRIEND

ATF2

activating transcription factor 2

112 Gene Product Result for
Synonyms: CRE-BP1 CREB2 HB16 TREB7
Gene ID:
Human(1386) Summary: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(11909) activating transcription factor 2
Rat(81647) activating transcription factor 2
Zebrafish(100006516) activating transcription factor 2
cow(509827) activating transcription factor 2
Horse(100053304) activating transcription factor 2
chicken(395727) activating transcription factor 2
domestic cat(101090884) activating transcription factor 2
dog(478806) activating transcription factor 2
sheep(101108548) activating transcription factor 2
domestic guinea pig(100726889) activating transcription factor 2
naked mole-rat(101717365) activating transcription factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A4086 Anti-ATF-2 (SS-16) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunoprecipitation (IP), microarray, western blot pricing
SAB4300317 Anti-ATF2 (Ab-112 or 94) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4300313 Anti-ATF2 (Ab-62 or 44) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300314 Anti-ATF2 (Ab-69 or 51) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4300315 Anti-ATF2 (Ab-71 or 53) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300316 Anti-ATF2 (Ab-73 or 55) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB2500129 Anti-ATF2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat
ELISA, western blot pricing
SAB1405654 Anti-ATF2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV34151 Anti-ATF2 antibody produced in rabbit IgG fraction of antiserum mouse, human, horse, rabbit, rat, canine, guinea pig
immunohistochemistry, western blot pricing
HPA022134 Anti-ATF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4500447 Anti-ATF2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500451 Anti-ATF2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2106324 Anti-ATF2 antibody produced in rabbit affinity isolated antibody rabbit, horse, rat, guinea pig, human
ELISA, western blot pricing
SAB4500446 Anti-ATF2, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat
ELISA, immunofluorescence pricing
SAB4500452 Anti-ATF2, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500448 Anti-ATF2, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500449 Anti-ATF2, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500450 Anti-ATF2, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2701908 Anti-atf2l antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
SAB4301343 Anti-phospho-ATF-2 (pSer472) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
P1248 Anti-phospho-ATF-2 (pSer490/pSer498) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
A4095 Anti-phospho-ATF-2 (pThr69,71) antibody, Mouse monoclonal clone ATF-22P, purified from hybridoma cell culture rat, chicken, frog, mouse, human
ELISA, immunocytochemistry, microarray, western blot pricing
A8853 Anti-phospho-ATF-2 (pThr71) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rodent
western blot pricing
SAB4504338 Anti-phospho-ATF2 (pSer112 or 94) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4300023 Anti-phospho-ATF2 (pSer112 or pSer94) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry pricing
SAB4504112 Anti-phospho-ATF2 (pSer480) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504339 Anti-phospho-ATF2 (pSer62 or 44) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300019 Anti-phospho-ATF2 (pSer62 or pSer44) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry pricing
SAB4504340 Anti-phospho-ATF2 (pThr69 or 51) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300020 Anti-phospho-ATF2 (pThr69 or pThr51) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry pricing
SAB4504341 Anti-phospho-ATF2 (pThr71 or 53) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300021 Anti-phospho-ATF2 (pThr71 or pThr53) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4504342 Anti-phospho-ATF2 (pThr73 or 55) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300022 Anti-phospho-ATF2 (pThr73 or pThr55) antibody produced in rabbit affinity isolated antibody mouse, human, monkey, rat
immunofluorescence, immunohistochemistry pricing
WH0001386M2 Monoclonal Anti-ATF2 antibody produced in mouse clone 1E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403693 Monoclonal Anti-ATF2 antibody produced in mouse clone 4C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
A6228 Monoclonal Anti-phospho-ATF-2 (pThr69,71)−Peroxidase antibody produced in mouse clone ATF-22P, purified immunoglobulin, lyophilized powder rat, chicken, frog, mouse, human
ELISA, immunocytochemistry, western blot pricing
PLA0202 Rabbit anti-ATF2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. primate, rhesus monkey, chimpanzee, marmoset, bovine, gorilla, human, rat, guinea pig, rabbit
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001880 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125521 MISSION® esiRNA esiRNA human ATF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001880 Rosetta Predictions human pricing
NM_031018 Rosetta Predictions rat pricing
XM_579498 Rosetta Predictions rat pricing
NM_001025093 Rosetta Predictions mouse pricing
NM_009715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147372 predicted 440
2 SASI_Hs01_00147373 predicted 596
3 SASI_Hs01_00147374 predicted 915
4 SASI_Hs01_00147375 predicted 418
5 SASI_Hs01_00147376 predicted 1129
6 SASI_Hs01_00147377 predicted 777
7 SASI_Hs01_00147378 predicted 1287
8 SASI_Hs01_00147379 predicted 1182
9 SASI_Hs01_00147380 predicted 426
10 SASI_Hs02_00332731 predicted 272
11 SASI_Hs01_00147381 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083331 predicted 514
2 SASI_Rn01_00083332 predicted 653
3 SASI_Rn01_00083333 predicted 955
4 SASI_Rn01_00083334 predicted 437
5 SASI_Rn01_00083335 predicted 618
6 SASI_Rn01_00083336 predicted 577
7 SASI_Rn01_00083337 predicted 966
8 SASI_Rn01_00083338 predicted 1193
9 SASI_Rn01_00083340 predicted 1321
10 SASI_Rn02_00264212 predicted 453
11 SASI_Rn01_00083339 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136425 predicted 1322
2 SASI_Rn01_00136426 predicted 1346
3 SASI_Rn01_00136427 predicted 1357
4 SASI_Rn01_00136428 predicted 1347
5 SASI_Rn01_00136429 predicted 1354
6 SASI_Rn01_00136430 predicted 1325
7 SASI_Rn01_00136431 predicted 1354
8 SASI_Rn01_00136432 predicted 1267
9 SASI_Rn01_00136433 predicted 1328
10 SASI_Rn01_00136434 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124712 predicted 1021
2 SASI_Mm01_00124713 predicted 1011
3 SASI_Mm01_00124714 predicted 1041
4 SASI_Mm01_00124715 predicted 1423
5 SASI_Mm01_00124716 predicted 1275
6 SASI_Mm01_00124717 predicted 1477
7 SASI_Mm01_00124718 predicted 1039
8 SASI_Mm01_00124719 predicted 898
9 SASI_Mm01_00124720 predicted 1643
10 SASI_Mm01_00124721 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170043 predicted 925
2 SASI_Mm01_00170044 predicted 913
3 SASI_Mm01_00170045 predicted 941
4 SASI_Mm01_00170046 predicted 1329
5 SASI_Mm01_00170047 predicted 1178
6 SASI_Mm01_00170048 predicted 1382
7 SASI_Mm01_00170049 predicted 941
8 SASI_Mm01_00170050 predicted 800
9 SASI_Mm01_00170051 predicted 1553
10 SASI_Mm01_00170052 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009715
VALIDATED
ATF2 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009715.1-2771s1c1
Sequence:CCGGGCGAGCTAACTTGTACTTATTCTCGAGAATAAGTACAAGTTAGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009715.1-944s1c1
Sequence:CCGGCCGTTGCTATTCCTGCATCAACTCGAGTTGATGCAGGAATAGCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009715.1-1120s1c1
Sequence:CCGGCCTCCAGTTACCAATGGTGATCTCGAGATCACCATTGGTAACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009715.1-1542s1c1
Sequence:CCGGCTGGCTATCATACTGCTGATACTCGAGTATCAGCAGTATGATAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009715.1-1297s1c1
Sequence:CCGGGCAGCTAATGAAGATCCTGATCTCGAGATCAGGATCTTCATTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-748s21c1
Sequence:CCGGATCGTTCGTCCAGCATCATTACTCGAGTAATGATGCTGGACGAACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-887s21c1
Sequence:CCGGTTCCTGTACCAGGCCCATTTCCTCGAGGAAATGGGCCTGGTACAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009715.2-947s21c1
Sequence:CCGGTTGCTATTCCTGCATCAATTACTCGAGTAATTGATGCAGGAATAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-2158s21c1
Sequence:CCGGATGGTAGTCTTGTTATCATTTCTCGAGAAATGATAACAAGACTACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-1329s21c1
Sequence:CCGGGAAGTTTCTAGAACGAAATAGCTCGAGCTATTTCGTTCTAGAAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-1859s21c1
Sequence:CCGGTGCGAAATCTGTGGTTGTAAACTCGAGTTTACAACCACAGATTTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009715
VALIDATED
ATF2 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009715.1-2771s1c1
Sequence:CCGGGCGAGCTAACTTGTACTTATTCTCGAGAATAAGTACAAGTTAGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009715.1-944s1c1
Sequence:CCGGCCGTTGCTATTCCTGCATCAACTCGAGTTGATGCAGGAATAGCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009715.1-1120s1c1
Sequence:CCGGCCTCCAGTTACCAATGGTGATCTCGAGATCACCATTGGTAACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009715.1-1542s1c1
Sequence:CCGGCTGGCTATCATACTGCTGATACTCGAGTATCAGCAGTATGATAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009715.1-1297s1c1
Sequence:CCGGGCAGCTAATGAAGATCCTGATCTCGAGATCAGGATCTTCATTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-748s21c1
Sequence:CCGGATCGTTCGTCCAGCATCATTACTCGAGTAATGATGCTGGACGAACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-887s21c1
Sequence:CCGGTTCCTGTACCAGGCCCATTTCCTCGAGGAAATGGGCCTGGTACAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009715.2-947s21c1
Sequence:CCGGTTGCTATTCCTGCATCAATTACTCGAGTAATTGATGCAGGAATAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-2158s21c1
Sequence:CCGGATGGTAGTCTTGTTATCATTTCTCGAGAAATGATAACAAGACTACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-1329s21c1
Sequence:CCGGGAAGTTTCTAGAACGAAATAGCTCGAGCTATTTCGTTCTAGAAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-1859s21c1
Sequence:CCGGTGCGAAATCTGTGGTTGTAAACTCGAGTTTACAACCACAGATTTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009715
VALIDATED
ATF2 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009715.1-2771s1c1
Sequence:CCGGGCGAGCTAACTTGTACTTATTCTCGAGAATAAGTACAAGTTAGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009715.1-944s1c1
Sequence:CCGGCCGTTGCTATTCCTGCATCAACTCGAGTTGATGCAGGAATAGCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009715.1-1120s1c1
Sequence:CCGGCCTCCAGTTACCAATGGTGATCTCGAGATCACCATTGGTAACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009715.1-1542s1c1
Sequence:CCGGCTGGCTATCATACTGCTGATACTCGAGTATCAGCAGTATGATAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009715.1-1297s1c1
Sequence:CCGGGCAGCTAATGAAGATCCTGATCTCGAGATCAGGATCTTCATTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-748s21c1
Sequence:CCGGATCGTTCGTCCAGCATCATTACTCGAGTAATGATGCTGGACGAACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-887s21c1
Sequence:CCGGTTCCTGTACCAGGCCCATTTCCTCGAGGAAATGGGCCTGGTACAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009715.2-947s21c1
Sequence:CCGGTTGCTATTCCTGCATCAATTACTCGAGTAATTGATGCAGGAATAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-2158s21c1
Sequence:CCGGATGGTAGTCTTGTTATCATTTCTCGAGAAATGATAACAAGACTACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-1329s21c1
Sequence:CCGGGAAGTTTCTAGAACGAAATAGCTCGAGCTATTTCGTTCTAGAAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009715.2-1859s21c1
Sequence:CCGGTGCGAAATCTGTGGTTGTAAACTCGAGTTTACAACCACAGATTTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001880
VALIDATED
ATF2 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001880.2-1862s1c1
Sequence:CCGGGCGAAATCTGTGGTTGTAAATCTCGAGATTTACAACCACAGATTTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001880.2-761s1c1
Sequence:CCGGGCATCATTACAGGTTCCCAATCTCGAGATTGGGAACCTGTAATGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_001880.2-1298s1c1
Sequence:CCGGGCAGCTAACGAAGATCCTGATCTCGAGATCAGGATCTTCGTTAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001880.2-1502s1c1
Sequence:CCGGGCTCATAAAGATTGCCCTGTACTCGAGTACAGGGCAATCTTTATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001880.2-866s1c1
Sequence:CCGGCCATCCTCTAACAGGCCAATTCTCGAGAATTGGCCTGTTAGAGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001880.2-1723s21c1
Sequence:GTACCGGTGCTCTTTCACAGATCGTTATCTCGAGATAACGATCTGTGAAAGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001880.2-1861s21c1
Sequence:GTACCGGTGCGAAATCTGTGGTTGTAAACTCGAGTTTACAACCACAGATTTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001880.2-600s21c1
Sequence:CCGGCTCTTGCAACACCTATCATAACTCGAGTTATGATAGGTGTTGCAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001880.2-519s21c1
Sequence:CCGGATGAGTTGGCGAGTCCATTTGCTCGAGCAAATGGACTCGCCAACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001880
VALIDATED
ATF2 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001880.2-1862s1c1
Sequence:CCGGGCGAAATCTGTGGTTGTAAATCTCGAGATTTACAACCACAGATTTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001880.2-761s1c1
Sequence:CCGGGCATCATTACAGGTTCCCAATCTCGAGATTGGGAACCTGTAATGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_001880.2-1298s1c1
Sequence:CCGGGCAGCTAACGAAGATCCTGATCTCGAGATCAGGATCTTCGTTAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001880.2-1502s1c1
Sequence:CCGGGCTCATAAAGATTGCCCTGTACTCGAGTACAGGGCAATCTTTATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001880.2-866s1c1
Sequence:CCGGCCATCCTCTAACAGGCCAATTCTCGAGAATTGGCCTGTTAGAGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001880.2-1723s21c1
Sequence:GTACCGGTGCTCTTTCACAGATCGTTATCTCGAGATAACGATCTGTGAAAGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001880.2-1861s21c1
Sequence:GTACCGGTGCGAAATCTGTGGTTGTAAACTCGAGTTTACAACCACAGATTTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001880.2-600s21c1
Sequence:CCGGCTCTTGCAACACCTATCATAACTCGAGTTATGATAGGTGTTGCAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001880.2-519s21c1
Sequence:CCGGATGAGTTGGCGAGTCCATTTGCTCGAGCAAATGGACTCGCCAACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001880
VALIDATED
ATF2 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001880.2-1862s1c1
Sequence:CCGGGCGAAATCTGTGGTTGTAAATCTCGAGATTTACAACCACAGATTTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001880.2-761s1c1
Sequence:CCGGGCATCATTACAGGTTCCCAATCTCGAGATTGGGAACCTGTAATGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_001880.2-1298s1c1
Sequence:CCGGGCAGCTAACGAAGATCCTGATCTCGAGATCAGGATCTTCGTTAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001880.2-1502s1c1
Sequence:CCGGGCTCATAAAGATTGCCCTGTACTCGAGTACAGGGCAATCTTTATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001880.2-866s1c1
Sequence:CCGGCCATCCTCTAACAGGCCAATTCTCGAGAATTGGCCTGTTAGAGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001880.2-1723s21c1
Sequence:GTACCGGTGCTCTTTCACAGATCGTTATCTCGAGATAACGATCTGTGAAAGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001880.2-1861s21c1
Sequence:GTACCGGTGCGAAATCTGTGGTTGTAAACTCGAGTTTACAACCACAGATTTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001880.2-600s21c1
Sequence:CCGGCTCTTGCAACACCTATCATAACTCGAGTTATGATAGGTGTTGCAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001880.2-519s21c1
Sequence:CCGGATGAGTTGGCGAGTCCATTTGCTCGAGCAAATGGACTCGCCAACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)