EMAIL THIS PAGE TO A FRIEND

ATF5

activating transcription factor 5

92 Gene Product Result for
Synonyms: ATFX HMFN0395
UniProtKB ID: Q9Y2D1, B3KND3, Q9BSA1, Q9UNQ3
Gene ID:
Mouse(107503) activating transcription factor 5
Rat(282840) activating transcription factor 5
cow(515654) activating transcription factor 5
dog(100688667) activating transcription factor 5
domestic cat(101092906) activating transcription factor 5
domestic guinea pig(100721314) activating transcription factor 5
sheep(101114972) activating transcription factor 5
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012068 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039491 MISSION® esiRNA esiRNA human ATF5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012068 Rosetta Predictions human pricing
NM_172336 Rosetta Predictions rat pricing
NM_030693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197398 predicted 1894
2 SASI_Hs01_00197400 predicted 1908
3 SASI_Hs01_00197402 predicted 1904
4 SASI_Hs01_00197403 predicted 1899
5 SASI_Hs01_00197404 predicted 1872
6 SASI_Hs01_00197396 predicted 1836
7 SASI_Hs01_00197401 predicted 1834
8 SASI_Hs02_00343533 predicted 1210
9 SASI_Hs02_00343534 predicted 621
10 SASI_Hs02_00343535 predicted 1737
11 SASI_Hs01_00197397 predicted 1602
12 SASI_Hs01_00197399 predicted 1600
13 SASI_Hs01_00197405 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269230 predicted 724
2 SASI_Rn01_00061837 predicted 767
3 SASI_Rn01_00061838 predicted 745
4 SASI_Rn01_00061840 predicted 780
5 SASI_Rn02_00269231 predicted 785
6 SASI_Rn01_00061842 predicted 808
7 SASI_Rn02_00269232 predicted 779
8 SASI_Rn02_00269233 predicted 713
9 SASI_Rn02_00269234 predicted 768
10 SASI_Rn02_00269235 predicted 812
11 SASI_Rn01_00061836 predicted 1256
12 SASI_Rn01_00061839 predicted 1250
13 SASI_Rn01_00061841 predicted 1346
14 SASI_Rn01_00061843 predicted 1082
15 SASI_Rn01_00061844 predicted 1440
16 SASI_Rn01_00061845 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105872 predicted 1056
2 SASI_Mm01_00105873 predicted 1229
3 SASI_Mm01_00105874 predicted 1241
4 SASI_Mm01_00105875 predicted 1063
5 SASI_Mm01_00105876 predicted 1236
6 SASI_Mm01_00105878 predicted 1061
7 SASI_Mm01_00105879 predicted 1188
8 SASI_Mm02_00336860 predicted 1229
9 SASI_Mm01_00105880 predicted 1041
10 SASI_Mm01_00105881 predicted 1031
11 SASI_Mm01_00105877 predicted 1324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012068
ATF5 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012068.4-1704s21c1
Sequence:CCGGTATCACCTCTCTTGCGTATTTCTCGAGAAATACGCAAGAGAGGTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012068.4-1780s21c1
Sequence:CCGGATGTCTATGCCCGTCACATAACTCGAGTTATGTGACGGGCATAGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-1093s1c1
Sequence:CCGGGCGCGAGATCCAGTACGTCAACTCGAGTTGACGTACTGGATCTCGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-781s1c1
Sequence:CCGGTGTCTTGGATACTCTGGACTTCTCGAGAAGTCCAGAGTATCCAAGACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-515s1c1
Sequence:CCGGTGGATGACTGAGCGAGTTGATCTCGAGATCAACTCGCTCAGTCATCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-386s1c1
Sequence:CCGGTGGCTCGTAGACTATGGGAAACTCGAGTTTCCCATAGTCTACGAGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-643s1c1
Sequence:CCGGGCTGGAACAGATGGAAGACTTCTCGAGAAGTCTTCCATCTGTTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012068
ATF5 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012068.4-1704s21c1
Sequence:CCGGTATCACCTCTCTTGCGTATTTCTCGAGAAATACGCAAGAGAGGTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012068.4-1780s21c1
Sequence:CCGGATGTCTATGCCCGTCACATAACTCGAGTTATGTGACGGGCATAGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-1093s1c1
Sequence:CCGGGCGCGAGATCCAGTACGTCAACTCGAGTTGACGTACTGGATCTCGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-781s1c1
Sequence:CCGGTGTCTTGGATACTCTGGACTTCTCGAGAAGTCCAGAGTATCCAAGACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-515s1c1
Sequence:CCGGTGGATGACTGAGCGAGTTGATCTCGAGATCAACTCGCTCAGTCATCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-386s1c1
Sequence:CCGGTGGCTCGTAGACTATGGGAAACTCGAGTTTCCCATAGTCTACGAGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-643s1c1
Sequence:CCGGGCTGGAACAGATGGAAGACTTCTCGAGAAGTCTTCCATCTGTTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012068
ATF5 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012068.4-1704s21c1
Sequence:CCGGTATCACCTCTCTTGCGTATTTCTCGAGAAATACGCAAGAGAGGTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012068.4-1780s21c1
Sequence:CCGGATGTCTATGCCCGTCACATAACTCGAGTTATGTGACGGGCATAGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-1093s1c1
Sequence:CCGGGCGCGAGATCCAGTACGTCAACTCGAGTTGACGTACTGGATCTCGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-781s1c1
Sequence:CCGGTGTCTTGGATACTCTGGACTTCTCGAGAAGTCCAGAGTATCCAAGACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-515s1c1
Sequence:CCGGTGGATGACTGAGCGAGTTGATCTCGAGATCAACTCGCTCAGTCATCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-386s1c1
Sequence:CCGGTGGCTCGTAGACTATGGGAAACTCGAGTTTCCCATAGTCTACGAGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012068.2-643s1c1
Sequence:CCGGGCTGGAACAGATGGAAGACTTCTCGAGAAGTCTTCCATCTGTTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030693
VALIDATED
ATF5 MISSION shRNA Bacterial Glycerol Stock
activating transcription factor 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030693.1-1231s21c1
Sequence:CCGGCTAACCCACTGTGGGCTATTTCTCGAGAAATAGCCCACAGTGGGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030693.1-1046s21c1
Sequence:CCGGGCGGGAGATCCAGTACGTGAACTCGAGTTCACGTACTGGATCTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030693.1-449s21c1
Sequence:CCGGTGACGGCTTCTCTGATTGGATCTCGAGATCCAATCAGAGAAGCCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030693.1-1070s21c1
Sequence:CCGGCCTGCTAATTGAGGTGTATAACTCGAGTTATACACCTCAATTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1046s1c1
Sequence:CCGGGCGGGAGATCCAGTACGTGAACTCGAGTTCACGTACTGGATCTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1070s1c1
Sequence:CCGGCCTGCTAATTGAGGTGTATAACTCGAGTTATACACCTCAATTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1057s1c1
Sequence:CCGGAGTACGTGAAGGACCTGCTAACTCGAGTTAGCAGGTCCTTCACGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1182s1c1
Sequence:CCGGCCCTCCATTCCACTTTCCTATCTCGAGATAGGAAAGTGGAATGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-449s1c1
Sequence:CCGGTGACGGCTTCTCTGATTGGATCTCGAGATCCAATCAGAGAAGCCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030693
VALIDATED
ATF5 MISSION shRNA shRNA Plasmid DNA
activating transcription factor 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030693.1-1231s21c1
Sequence:CCGGCTAACCCACTGTGGGCTATTTCTCGAGAAATAGCCCACAGTGGGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030693.1-1046s21c1
Sequence:CCGGGCGGGAGATCCAGTACGTGAACTCGAGTTCACGTACTGGATCTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030693.1-449s21c1
Sequence:CCGGTGACGGCTTCTCTGATTGGATCTCGAGATCCAATCAGAGAAGCCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030693.1-1070s21c1
Sequence:CCGGCCTGCTAATTGAGGTGTATAACTCGAGTTATACACCTCAATTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1046s1c1
Sequence:CCGGGCGGGAGATCCAGTACGTGAACTCGAGTTCACGTACTGGATCTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1070s1c1
Sequence:CCGGCCTGCTAATTGAGGTGTATAACTCGAGTTATACACCTCAATTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1057s1c1
Sequence:CCGGAGTACGTGAAGGACCTGCTAACTCGAGTTAGCAGGTCCTTCACGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1182s1c1
Sequence:CCGGCCCTCCATTCCACTTTCCTATCTCGAGATAGGAAAGTGGAATGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-449s1c1
Sequence:CCGGTGACGGCTTCTCTGATTGGATCTCGAGATCCAATCAGAGAAGCCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030693
VALIDATED
ATF5 MISSION shRNA Lentiviral Transduction Particles
activating transcription factor 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030693.1-1231s21c1
Sequence:CCGGCTAACCCACTGTGGGCTATTTCTCGAGAAATAGCCCACAGTGGGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030693.1-1046s21c1
Sequence:CCGGGCGGGAGATCCAGTACGTGAACTCGAGTTCACGTACTGGATCTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030693.1-449s21c1
Sequence:CCGGTGACGGCTTCTCTGATTGGATCTCGAGATCCAATCAGAGAAGCCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030693.1-1070s21c1
Sequence:CCGGCCTGCTAATTGAGGTGTATAACTCGAGTTATACACCTCAATTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1046s1c1
Sequence:CCGGGCGGGAGATCCAGTACGTGAACTCGAGTTCACGTACTGGATCTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1070s1c1
Sequence:CCGGCCTGCTAATTGAGGTGTATAACTCGAGTTATACACCTCAATTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1057s1c1
Sequence:CCGGAGTACGTGAAGGACCTGCTAACTCGAGTTAGCAGGTCCTTCACGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-1182s1c1
Sequence:CCGGCCCTCCATTCCACTTTCCTATCTCGAGATAGGAAAGTGGAATGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030693.1-449s1c1
Sequence:CCGGTGACGGCTTCTCTGATTGGATCTCGAGATCCAATCAGAGAAGCCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)