ATM

ataxia telangiectasia mutated

162 Gene Product Result for

Synonyms: AT1 ATA ATC ATD ATDC ATE TEL1 TELO1

Species: Human ATM(472), Mouse Atm(11920), Rat Atm(300711), Zebrafish atm(403064), cow ATM(526824), Horse ATM(100061765), domestic cat ATM(101089291), dog ATM(479450), chicken ATM(395401), Thale Cress ATM(823975), naked mole-rat Atm(101718948), domestic guinea pig Atm(100717983), sheep ATM(101105847)

UniProtKB ID: Q13315, B2RNX5, O15429, Q12758, Q16551, Q93007, Q9NP02, Q9UCX7

Gene ID:

Human(472) Summary: The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

Mouse(11920) ataxia telangiectasia mutated homolog (human)

Rat(300711) ataxia telangiectasia mutated

Zebrafish(403064) ataxia telangiectasia mutated

cow(526824) ataxia telangiectasia mutated

Horse(100061765) ataxia telangiectasia mutated

domestic cat(101089291) ataxia telangiectasia mutated

dog(479450) ataxia telangiectasia mutated

chicken(395401) ataxia telangiectasia mutated

Thale Cress(823975) serine/threonine-protein kinase ATM

naked mole-rat(101718948) ataxia telangiectasia mutated

domestic guinea pig(100717983) ataxia telangiectasia mutated

sheep(101105847) ataxia telangiectasia mutated

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB5500009	Anti-Androgen Receptor (C-term) antibody, Rabbit monoclonal clone SP224, recombinant, expressed in proprietary host, affinity isolated antibody	human (tested)	flow cytometry, immunohistochemistry	pricing

SAB4300417	Anti-ATM (Ab-1981) antibody produced in rabbit affinity isolated antibody	human	immunofluorescence, western blot	pricing

GW21178	Anti-ATM antibody produced in chicken affinity isolated antibody, buffered aqueous solution	mouse, human	western blot	pricing

SAB3500147	Anti-ATM antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

SAB4501968	Anti-ATM antibody produced in rabbit affinity isolated antibody	human, mouse	ELISA, immunohistochemistry	pricing

HPA067142	Anti-ATM antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody	human	immunofluorescence	pricing

A6218	Anti-ATM antibody, Mouse monoclonal clone SYML6A10, purified from hybridoma cell culture	human	immunocytochemistry, microarray, western blot	pricing

A6093	Anti-ATM antibody, Mouse monoclonal clone SYR6D4, purified from hybridoma cell culture	human	immunocytochemistry, immunoprecipitation (IP), microarray, western blot	pricing

A1106	Anti-ATM antibody,Mouse monoclonal clone MAT3-4G10/8, purified from hybridoma cell culture	human, mouse	ELISA, immunoprecipitation (IP), western blot	pricing

SAB4300100	Anti-phospho-ATM (pSer¹⁹⁸¹) antibody produced in rabbit affinity isolated antibody	human	immunohistochemistry	pricing

PLA0045	Goat anti-ATM Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc.	human	immunoprecipitation (IP), proximity ligation assay, western blot	pricing

SAB1402696	Monoclonal Anti-ATM antibody produced in mouse clone 2C10, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunofluorescence	pricing

PLA0086	Rabbit anti-ATM Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc.	human	immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN1219	CompoZr^® Knockout ZFN Kit Human ATM (NM_138292)	pricing

CKOZFN1371	CompoZr^® Knockout ZFN Kit Human ATM (NM_138292)	pricing

CKOZFN27166	CompoZr^® Knockout ZFN Kit Mouse Atm (NM_007499.2)	pricing

CKOZFN50921	CompoZr^® Knockout ZFN Kit Rat Atm (NM_001106821)	pricing

CKOZFND1219	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human ATM (NM_138292)	pricing

CKOZFND1371	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human ATM (NM_138292)	pricing

CKOZFND27166	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Atm (NM_007499.2)	pricing

CKOZFND50921	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Atm (NM_001106821)	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST92696	PrEST Antigen ATM Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST26375	SILu^™PrEST ATM SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

AQUA Peptides

Product #	Description	Species	Add to Cart

AQ0424	AQUA^™ Peptide YRPNDFSAFQCQ[K]	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_007499	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_007499	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_007499	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_000051	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_000051	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_000051	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU089521	MISSION^® esiRNA esiRNA human ATM (esiRNA1)	human	pricing

siRNA Nano Scale

Product #	Description	Species	Add to Cart

SIHK0133	MISSION^® siRNA Human Kinase ATM (siRNA1), Nano Scale 0.25 nmol	human	pricing

SIHK0134	MISSION^® siRNA Human Kinase ATM (siRNA2), Nano Scale 0.25 nmol	human	pricing

SIHK0136	MISSION^® siRNA Human Kinase ATM (siRNA4), Nano Scale 0.25 nmol	human	pricing

SIHK0135	MISSION^® siRNA Human Kinase ATM (siRNA3), Nano Scale 0.25 nmol	human	pricing

Related Products

Product #	Description	Add to Cart

05-513	Anti-ATM Antibody, clone AM9 Detect ATM also known as Ataxia Telangiectasia Mutated with Anti-ATM Antibody, clone AM9 (Mouse Monoclonal Antibody), that has been demonstrated to work in WB.	pricing

MAB3806	Anti-ATM phosphoSer1981 Antibody, clone 10H11.E12 Anti-ATM Antibody, phosphoSer1981, clone 10H11.E12 is a Mouse Monoclonal Antibody for detection of ATM also known as Ataxia Telangiectasia Mutated & has been validated in IP, WB, ICC.	pricing

05-740	Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12 Use Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12 (Mouse Monoclonal Antibody) validated in ICC, IF, IP, WB to detect phospho-ATM (Ser1981) also known as A-T mutated.	pricing

05-740-AF488	Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12, Alexa Fluor® 488 Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12, Alexa Fluor® 488 is an antibody against phospho-ATM (Ser1981) for use in Immunocytochemistry.	pricing

MAB3806-C	Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12, Ascites Free Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12, Ascites Free is an antibody against phospho-ATM for use in Immunocytochemistry, Immunoprecipitation, ELISA, Western Blotting.	pricing

FCMAB110P	Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12 PE conjugate Anti-phospho-ATM (Ser1981) Antibody, clone 10H11.E12 PE conjugate detects level of phospho-ATM (Ser1981) & has been published & validated for use in FC.	pricing

14-933-M	ATM, active	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_000051	siRNAs that have been validated in the lab	human	pricing
NM_138292	Rosetta Predictions	human	pricing
NM_001106821	Rosetta Predictions	rat	pricing
NM_007499	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_000051	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00093615 validated	8463
2	SASI_Hs01_00093616 predicted	6463
3	SASI_Hs01_00093617 predicted	6460
4	SASI_Hs02_00301751 predicted	7936
5	SASI_Hs01_00093620 predicted	5302
6	SASI_Hs02_00301752 predicted	5382
7	SASI_Hs01_00093621 predicted	6967
8	SASI_Hs01_00093622 predicted	7044
9	SASI_Hs02_00301753 predicted	8158
10	SASI_Hs02_00301754 predicted	8018
11	SASI_Hs02_00301755 predicted	5295
12	SASI_Hs01_00093614 predicted	4779
13	SASI_Hs01_00093618 predicted	8940
14	SASI_Hs01_00093619 predicted	7304
15	SASI_Hs01_00093623 predicted	8264

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_138292	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00028583 predicted	2298
2	SASI_Hs01_00028584 predicted	2284
3	SASI_Hs02_00363381 predicted	3770
4	SASI_Hs01_00028586 predicted	1135
5	SASI_Hs02_00363382 predicted	1207
6	SASI_Hs01_00028588 predicted	2797
7	SASI_Hs01_00028589 predicted	2871
8	SASI_Hs02_00363383 predicted	3986
9	SASI_Hs02_00363384 predicted	3844
10	SASI_Hs02_00363385 predicted	1125
11	SASI_Hs01_00028581 predicted	611
12	SASI_Hs01_00028582 predicted	4287
13	SASI_Hs01_00028585 predicted	4766
14	SASI_Hs01_00028587 predicted	2045
15	SASI_Hs01_00028590 predicted	4095

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001106821	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00222738 predicted	8981
2	SASI_Rn02_00222739 predicted	1580
3	SASI_Rn02_00222740 predicted	615
4	SASI_Rn02_00222741 predicted	2999
5	SASI_Rn02_00222742 predicted	6106
6	SASI_Rn02_00222743 predicted	6191
7	SASI_Rn02_00222744 predicted	8216
8	SASI_Rn02_00222745 predicted	1679
9	SASI_Rn02_00222746 predicted	1453
10	SASI_Rn02_00222747 predicted	8115

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_007499	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00065839 predicted	526
2	SASI_Mm01_00065840 predicted	1660
3	SASI_Mm01_00065842 predicted	6663
4	SASI_Mm02_00311774 predicted	5127
5	SASI_Mm01_00065843 predicted	1599
6	SASI_Mm01_00065845 predicted	917
7	SASI_Mm01_00065846 predicted	4136
8	SASI_Mm01_00065848 predicted	2311
9	SASI_Mm02_00311775 predicted	4712
10	SASI_Mm02_00311776 predicted	6515
11	SASI_Mm01_00065841 predicted	1826
12	SASI_Mm01_00065844 predicted	2797
13	SASI_Mm01_00065847 predicted	6003

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_007499 VALIDATED	ATM MISSION shRNA Bacterial Glycerol Stock ataxia telangiectasia mutated	Mouse

9 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000360397
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-1375s21c1
	Sequence:CCGGACAGATTACAACCCGATTAATCTCGAGATTAATCGGGTTGTAATCTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360400
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007499.2-6245s21c1
	Sequence:CCGGCTTACTAGAATACGGACATATCTCGAGATATGTCCGTATTCTAGTAAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360327
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-4635s21c1
	Sequence:CCGGCCCTTTGCTGTGACCTATTAACTCGAGTTAATAGGTCACAGCAAAGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360328
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-8240s21c1
	Sequence:CCGGCGCTTAGCTGGAGGCTTAAATCTCGAGATTTAAGCCTCCAGCTAAGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360398
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-1602s21c1
	Sequence:CCGGCTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012643
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.78	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_007499.1-9283s1c1
	Sequence:CCGGCCACCATATTTGGACAGGAATCTCGAGATTCCTGTCCAAATATGGTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012644
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007499.1-1824s1c1
	Sequence:CCGGCCTCCAATTCTTCAGCGTAATCTCGAGATTACGCTGAAGAATTGGAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012646
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007499.1-8872s1c1
	Sequence:CCGGCGATGGAAGTTATGCGGAGTTCTCGAGAACTCCGCATAACTTCCATCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012647
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_007499.1-1129s1c1
	Sequence:CCGGCCGTGGAGATTTCTCAATCTTCTCGAGAAGATTGAGAAATCTCCACGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_007499 VALIDATED	ATM MISSION shRNA shRNA Plasmid DNA ataxia telangiectasia mutated	Mouse

9 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000360397
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-1375s21c1
	Sequence:CCGGACAGATTACAACCCGATTAATCTCGAGATTAATCGGGTTGTAATCTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360400
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007499.2-6245s21c1
	Sequence:CCGGCTTACTAGAATACGGACATATCTCGAGATATGTCCGTATTCTAGTAAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360327
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-4635s21c1
	Sequence:CCGGCCCTTTGCTGTGACCTATTAACTCGAGTTAATAGGTCACAGCAAAGGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360328
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-8240s21c1
	Sequence:CCGGCGCTTAGCTGGAGGCTTAAATCTCGAGATTTAAGCCTCCAGCTAAGCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360398
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-1602s21c1
	Sequence:CCGGCTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012643
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.78	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_007499.1-9283s1c1
	Sequence:CCGGCCACCATATTTGGACAGGAATCTCGAGATTCCTGTCCAAATATGGTGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012644
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007499.1-1824s1c1
	Sequence:CCGGCCTCCAATTCTTCAGCGTAATCTCGAGATTACGCTGAAGAATTGGAGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012646
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007499.1-8872s1c1
	Sequence:CCGGCGATGGAAGTTATGCGGAGTTCTCGAGAACTCCGCATAACTTCCATCGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012647
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_007499.1-1129s1c1
	Sequence:CCGGCCGTGGAGATTTCTCAATCTTCTCGAGAAGATTGAGAAATCTCCACGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_007499 VALIDATED	ATM MISSION shRNA Lentiviral Transduction Particles ataxia telangiectasia mutated	Mouse

9 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000360397
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-1375s21c1
	Sequence:CCGGACAGATTACAACCCGATTAATCTCGAGATTAATCGGGTTGTAATCTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360400
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007499.2-6245s21c1
	Sequence:CCGGCTTACTAGAATACGGACATATCTCGAGATATGTCCGTATTCTAGTAAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360327
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-4635s21c1
	Sequence:CCGGCCCTTTGCTGTGACCTATTAACTCGAGTTAATAGGTCACAGCAAAGGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360328
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-8240s21c1
	Sequence:CCGGCGCTTAGCTGGAGGCTTAAATCTCGAGATTTAAGCCTCCAGCTAAGCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000360398
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_007499.2-1602s21c1
	Sequence:CCGGCTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012643
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.78	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_007499.1-9283s1c1
	Sequence:CCGGCCACCATATTTGGACAGGAATCTCGAGATTCCTGTCCAAATATGGTGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012644
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007499.1-1824s1c1
	Sequence:CCGGCCTCCAATTCTTCAGCGTAATCTCGAGATTACGCTGAAGAATTGGAGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012646
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007499.1-8872s1c1
	Sequence:CCGGCGATGGAAGTTATGCGGAGTTCTCGAGAACTCCGCATAACTTCCATCGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000012647
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_007499.1-1129s1c1
	Sequence:CCGGCCGTGGAGATTTCTCAATCTTCTCGAGAAGATTGAGAAATCTCCACGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_000051 VALIDATED	ATM MISSION shRNA Bacterial Glycerol Stock ataxia telangiectasia mutated	Human

24 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000194969
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-9358s1c1
	Sequence:CCGGCAAACGAAATCTCAGTGATATCTCGAGATATCACTGAGATTTCGTTTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195732
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-8423s1c1
	Sequence:CCGGCTGGTGACTATACAGTCATTTCTCGAGAAATGACTGTATAGTCACCAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196335
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-1851s1c1
	Sequence:CCGGGTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATACTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196661
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-6606s1c1
	Sequence:CCGGGCCATATTCTTTCCGTCTATTCTCGAGAATAGACGGAAAGAATATGGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196966
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.3-12465s1c1
	Sequence:CCGGGCTAAGTCACTGACCCATATTCTCGAGAATATGGGTCAGTGACTTAGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245109
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-9548s21c1
	Sequence:CCGGTGGGTGTGATCTTCAGTATATCTCGAGATATACTGAAGATCACACCCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245108
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-684s21c1
	Sequence:CCGGTGGTCAAATACTTCATCAAATCTCGAGATTTGATGAAGTATTTGACCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245106
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-420s21c1
	Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194686
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-2794s1c1
	Sequence:CCGGCCTGCGATTGTTAACATCAAACTCGAGTTTGATGTTAACAATCGCAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194816
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.3-12839s1c1
	Sequence:CCGGCACAAACTCTTGGTCATTATACTCGAGTATAATGACCAAGAGTTTGTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194861
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.3-4332s1c1
	Sequence:CCGGCCAAGGTCTATGATATGCTTACTCGAGTAAGCATATCATAGACCTTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038656
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-1717s1c1
	Sequence:CCGGGCCATAATTCAGGGTAGTTTACTCGAGTAAACTACCCTGAATTATGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010299
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.x-9530s1c1
	Sequence:CCGGTGATGGTCTTAAGGAACATCTCTCGAGAGATGTTCCTTAAGACCATCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245107
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-488s21c1
	Sequence:CCGGCGAGATCCTGAAACAATTAAACTCGAGTTTAATTGTTTCAGGATCTCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245110
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000051.3-11568s21c1
	Sequence:CCGGTCGTGTATTAGTGAGTATAATCTCGAGATTATACTCACTAATACACGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195474
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.3-12787s1c1
	Sequence:CCGGCCTACTTTGTGCAGGTCATACCTCGAGGTATGACCTGCACAAAGTAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039948
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.51	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.2-9380s1c1
	Sequence:CCGGCCTTTCATTCAGCCTTTAGAACTCGAGTTCTAAAGGCTGAATGAAAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038655
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-224s1c1
	Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038654
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.2-9426s1c1
	Sequence:CCGGCCTGCCAACATACTTTAAGTACTCGAGTACTTAAAGTATGTTGGCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039949
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-2990s1c1
	Sequence:CCGGGCACGCTAGAACCTACCAAATCTCGAGATTTGGTAGGTTCTAGCGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039950
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-3610s1c1
	Sequence:CCGGCCTGAAACTTTGGATGAAATTCTCGAGAATTTCATCCAAAGTTTCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039951
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.2-1974s1c1
	Sequence:CCGGGCCTCCAATTCTTCACAGTAACTCGAGTTACTGTGAAGAATTGGAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038658
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-9211s1c1
	Sequence:CCGGCGTGTCTTAATGAGACTACAACTCGAGTTGTAGTCTCATTAAGACACGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039952
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-751s1c1
	Sequence:CCGGGCTAGAATAATTCATGCTGTTCTCGAGAACAGCATGAATTATTCTAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_000051 VALIDATED	ATM MISSION shRNA shRNA Plasmid DNA ataxia telangiectasia mutated	Human

24 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000194969
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-9358s1c1
	Sequence:CCGGCAAACGAAATCTCAGTGATATCTCGAGATATCACTGAGATTTCGTTTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195732
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-8423s1c1
	Sequence:CCGGCTGGTGACTATACAGTCATTTCTCGAGAAATGACTGTATAGTCACCAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196335
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-1851s1c1
	Sequence:CCGGGTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATACTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196661
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-6606s1c1
	Sequence:CCGGGCCATATTCTTTCCGTCTATTCTCGAGAATAGACGGAAAGAATATGGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196966
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.3-12465s1c1
	Sequence:CCGGGCTAAGTCACTGACCCATATTCTCGAGAATATGGGTCAGTGACTTAGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245109
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-9548s21c1
	Sequence:CCGGTGGGTGTGATCTTCAGTATATCTCGAGATATACTGAAGATCACACCCATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245108
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-684s21c1
	Sequence:CCGGTGGTCAAATACTTCATCAAATCTCGAGATTTGATGAAGTATTTGACCATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245106
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-420s21c1
	Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194686
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-2794s1c1
	Sequence:CCGGCCTGCGATTGTTAACATCAAACTCGAGTTTGATGTTAACAATCGCAGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194816
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.3-12839s1c1
	Sequence:CCGGCACAAACTCTTGGTCATTATACTCGAGTATAATGACCAAGAGTTTGTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194861
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.3-4332s1c1
	Sequence:CCGGCCAAGGTCTATGATATGCTTACTCGAGTAAGCATATCATAGACCTTGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038656
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-1717s1c1
	Sequence:CCGGGCCATAATTCAGGGTAGTTTACTCGAGTAAACTACCCTGAATTATGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010299
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.x-9530s1c1
	Sequence:CCGGTGATGGTCTTAAGGAACATCTCTCGAGAGATGTTCCTTAAGACCATCATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245107
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-488s21c1
	Sequence:CCGGCGAGATCCTGAAACAATTAAACTCGAGTTTAATTGTTTCAGGATCTCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245110
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000051.3-11568s21c1
	Sequence:CCGGTCGTGTATTAGTGAGTATAATCTCGAGATTATACTCACTAATACACGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195474
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.3-12787s1c1
	Sequence:CCGGCCTACTTTGTGCAGGTCATACCTCGAGGTATGACCTGCACAAAGTAGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039948
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.51	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.2-9380s1c1
	Sequence:CCGGCCTTTCATTCAGCCTTTAGAACTCGAGTTCTAAAGGCTGAATGAAAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038655
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-224s1c1
	Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038654
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.2-9426s1c1
	Sequence:CCGGCCTGCCAACATACTTTAAGTACTCGAGTACTTAAAGTATGTTGGCAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039949
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-2990s1c1
	Sequence:CCGGGCACGCTAGAACCTACCAAATCTCGAGATTTGGTAGGTTCTAGCGTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039950
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-3610s1c1
	Sequence:CCGGCCTGAAACTTTGGATGAAATTCTCGAGAATTTCATCCAAAGTTTCAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039951
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.2-1974s1c1
	Sequence:CCGGGCCTCCAATTCTTCACAGTAACTCGAGTTACTGTGAAGAATTGGAGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038658
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-9211s1c1
	Sequence:CCGGCGTGTCTTAATGAGACTACAACTCGAGTTGTAGTCTCATTAAGACACGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039952
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-751s1c1
	Sequence:CCGGGCTAGAATAATTCATGCTGTTCTCGAGAACAGCATGAATTATTCTAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_000051 VALIDATED	ATM MISSION shRNA Lentiviral Transduction Particles ataxia telangiectasia mutated	Human

24 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000194969
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-9358s1c1
	Sequence:CCGGCAAACGAAATCTCAGTGATATCTCGAGATATCACTGAGATTTCGTTTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195732
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-8423s1c1
	Sequence:CCGGCTGGTGACTATACAGTCATTTCTCGAGAAATGACTGTATAGTCACCAGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196335
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-1851s1c1
	Sequence:CCGGGTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATACTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196661
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-6606s1c1
	Sequence:CCGGGCCATATTCTTTCCGTCTATTCTCGAGAATAGACGGAAAGAATATGGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196966
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.3-12465s1c1
	Sequence:CCGGGCTAAGTCACTGACCCATATTCTCGAGAATATGGGTCAGTGACTTAGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245109
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-9548s21c1
	Sequence:CCGGTGGGTGTGATCTTCAGTATATCTCGAGATATACTGAAGATCACACCCATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245108
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-684s21c1
	Sequence:CCGGTGGTCAAATACTTCATCAAATCTCGAGATTTGATGAAGTATTTGACCATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245106
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-420s21c1
	Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194686
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.3-2794s1c1
	Sequence:CCGGCCTGCGATTGTTAACATCAAACTCGAGTTTGATGTTAACAATCGCAGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194816
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.3-12839s1c1
	Sequence:CCGGCACAAACTCTTGGTCATTATACTCGAGTATAATGACCAAGAGTTTGTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194861
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.3-4332s1c1
	Sequence:CCGGCCAAGGTCTATGATATGCTTACTCGAGTAAGCATATCATAGACCTTGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038656
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-1717s1c1
	Sequence:CCGGGCCATAATTCAGGGTAGTTTACTCGAGTAAACTACCCTGAATTATGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010299
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.x-9530s1c1
	Sequence:CCGGTGATGGTCTTAAGGAACATCTCTCGAGAGATGTTCCTTAAGACCATCATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245107
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000051.3-488s21c1
	Sequence:CCGGCGAGATCCTGAAACAATTAAACTCGAGTTTAATTGTTTCAGGATCTCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000245110
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000051.3-11568s21c1
	Sequence:CCGGTCGTGTATTAGTGAGTATAATCTCGAGATTATACTCACTAATACACGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195474
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.3-12787s1c1
	Sequence:CCGGCCTACTTTGTGCAGGTCATACCTCGAGGTATGACCTGCACAAAGTAGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039948
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.51	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.2-9380s1c1
	Sequence:CCGGCCTTTCATTCAGCCTTTAGAACTCGAGTTCTAAAGGCTGAATGAAAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038655
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-224s1c1
	Sequence:CCGGGCCGTCAACTAGAACATGATACTCGAGTATCATGTTCTAGTTGACGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038654
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000051.2-9426s1c1
	Sequence:CCGGCCTGCCAACATACTTTAAGTACTCGAGTACTTAAAGTATGTTGGCAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039949
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-2990s1c1
	Sequence:CCGGGCACGCTAGAACCTACCAAATCTCGAGATTTGGTAGGTTCTAGCGTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039950
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-3610s1c1
	Sequence:CCGGCCTGAAACTTTGGATGAAATTCTCGAGAATTTCATCCAAAGTTTCAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039951
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000051.2-1974s1c1
	Sequence:CCGGGCCTCCAATTCTTCACAGTAACTCGAGTTACTGTGAAGAATTGGAGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000038658
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-9211s1c1
	Sequence:CCGGCGTGTCTTAATGAGACTACAACTCGAGTTGTAGTCTCATTAAGACACGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039952
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000051.2-751s1c1
	Sequence:CCGGGCTAGAATAATTCATGCTGTTCTCGAGAACAGCATGAATTATTCTAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart