EMAIL THIS PAGE TO A FRIEND

ATMIN

ATM interactor

96 Gene Product Result for
Synonyms: ASCIZ ZNF822
UniProtKB ID: O43313, A8K4H8, Q68DC9
Gene ID:
Mouse(234776) ATM interactor
Rat(315037) ATM interactor
Zebrafish(368760) ATM interactor
cow(781217) ATM interactor
Horse(100069801) ATM interactor
domestic cat(101084077) ATM interactor
dog(100688833) ATM interactor
chicken(426138) ATM interactor
sheep(101120266) ATM interactor
naked mole-rat(101725360) ATM interactor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015251 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015251 Rosetta Predictions human pricing
XM_001078346 Rosetta Predictions rat pricing
XM_235378 Rosetta Predictions rat pricing
NM_177700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244120 predicted 1607
2 SASI_Hs01_00244121 predicted 905
3 SASI_Hs01_00244122 predicted 876
4 SASI_Hs01_00244123 predicted 1777
5 SASI_Hs01_00244124 predicted 2427
6 SASI_Hs02_00347387 predicted 1662
7 SASI_Hs01_00244126 predicted 1133
8 SASI_Hs01_00244127 predicted 2266
9 SASI_Hs01_00244128 predicted 859
10 SASI_Hs01_00244129 predicted 1185
11 SASI_Hs01_00244125 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360484 predicted 2167
2 SASI_Rn02_00360485 predicted 975
3 SASI_Rn02_00360486 predicted 1349
4 SASI_Rn02_00360487 predicted 2202
5 SASI_Rn02_00360488 predicted 1581
6 SASI_Rn02_00360489 predicted 1015
7 SASI_Rn02_00360490 predicted 388
8 SASI_Rn02_00360491 predicted 448
9 SASI_Rn02_00360492 predicted 1558
10 SASI_Rn02_00360493 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389222 predicted 994
2 SASI_Rn02_00389223 predicted 2174
3 SASI_Rn02_00389224 predicted 1366
4 SASI_Rn02_00389225 predicted 2211
5 SASI_Rn02_00389226 predicted 1596
6 SASI_Rn02_00389227 predicted 1031
7 SASI_Rn02_00389228 predicted 409
8 SASI_Rn02_00389229 predicted 468
9 SASI_Rn02_00389230 predicted 1572
10 SASI_Rn02_00389231 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040400 predicted 345
2 SASI_Mm01_00040401 predicted 2274
3 SASI_Mm01_00040402 predicted 1027
4 SASI_Mm01_00040403 predicted 1791
5 SASI_Mm01_00040405 predicted 2111
6 SASI_Mm01_00040406 predicted 1570
7 SASI_Mm02_00348047 predicted 1734
8 SASI_Mm01_00040407 predicted 388
9 SASI_Mm01_00040408 predicted 1624
10 SASI_Mm01_00040409 predicted 450
11 SASI_Mm01_00040404 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015251
VALIDATED
ATMIN MISSION shRNA Bacterial Glycerol Stock
ATM interactor
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-2363s1c1
Sequence:CCGGGCAACGAAACTCAGACAGCAACTCGAGTTGCTGTCTGAGTTTCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-1502s1c1
Sequence:CCGGCCAGTGGGATAGAAAGTCCAACTCGAGTTGGACTTTCTATCCCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015251.2-2314s1c1
Sequence:CCGGCAGACCATGAGTTCTGGGTTTCTCGAGAAACCCAGAACTCATGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015251.2-3018s1c1
Sequence:CCGGCGTCAGCTTTGACACCTCTTTCTCGAGAAAGAGGTGTCAAAGCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-866s1c1
Sequence:CCGGCTCTTACAACACCACCGAGATCTCGAGATCTCGGTGGTGTTGTAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-2039s1c1
Sequence:CCGGCGGACTTCTTACTCGCAGATACTCGAGTATCTGCGAGTAAGAAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015251.2-4236s1c1
Sequence:CCGGGCCTGTATTACTGAAAGCTAACTCGAGTTAGCTTTCAGTAATACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-729s1c1
Sequence:CCGGGAAGTTATCCAACAAGACCATCTCGAGATGGTCTTGTTGGATAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015251.2-3844s1c1
Sequence:CCGGCCTTCCATTCACCATTCTTTACTCGAGTAAAGAATGGTGAATGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-2950s21c1
Sequence:GTACCGGGATGCTGCCACCGTAGGATTTCTCGAGAAATCCTACGGTGGCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-729s21c1
Sequence:CCGGGAAGTTATCCAACAAGACCATCTCGAGATGGTCTTGTTGGATAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-866s21c1
Sequence:CCGGCTCTTACAACACCACCGAGATCTCGAGATCTCGGTGGTGTTGTAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-2039s21c1
Sequence:CCGGCGGACTTCTTACTCGCAGATACTCGAGTATCTGCGAGTAAGAAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-1502s21c1
Sequence:CCGGCCAGTGGGATAGAAAGTCCAACTCGAGTTGGACTTTCTATCCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015251
VALIDATED
ATMIN MISSION shRNA shRNA Plasmid DNA
ATM interactor
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-2363s1c1
Sequence:CCGGGCAACGAAACTCAGACAGCAACTCGAGTTGCTGTCTGAGTTTCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-1502s1c1
Sequence:CCGGCCAGTGGGATAGAAAGTCCAACTCGAGTTGGACTTTCTATCCCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015251.2-2314s1c1
Sequence:CCGGCAGACCATGAGTTCTGGGTTTCTCGAGAAACCCAGAACTCATGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015251.2-3018s1c1
Sequence:CCGGCGTCAGCTTTGACACCTCTTTCTCGAGAAAGAGGTGTCAAAGCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-866s1c1
Sequence:CCGGCTCTTACAACACCACCGAGATCTCGAGATCTCGGTGGTGTTGTAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-2039s1c1
Sequence:CCGGCGGACTTCTTACTCGCAGATACTCGAGTATCTGCGAGTAAGAAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015251.2-4236s1c1
Sequence:CCGGGCCTGTATTACTGAAAGCTAACTCGAGTTAGCTTTCAGTAATACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-729s1c1
Sequence:CCGGGAAGTTATCCAACAAGACCATCTCGAGATGGTCTTGTTGGATAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015251.2-3844s1c1
Sequence:CCGGCCTTCCATTCACCATTCTTTACTCGAGTAAAGAATGGTGAATGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-2950s21c1
Sequence:GTACCGGGATGCTGCCACCGTAGGATTTCTCGAGAAATCCTACGGTGGCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-729s21c1
Sequence:CCGGGAAGTTATCCAACAAGACCATCTCGAGATGGTCTTGTTGGATAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-866s21c1
Sequence:CCGGCTCTTACAACACCACCGAGATCTCGAGATCTCGGTGGTGTTGTAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-2039s21c1
Sequence:CCGGCGGACTTCTTACTCGCAGATACTCGAGTATCTGCGAGTAAGAAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-1502s21c1
Sequence:CCGGCCAGTGGGATAGAAAGTCCAACTCGAGTTGGACTTTCTATCCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015251
VALIDATED
ATMIN MISSION shRNA Lentiviral Transduction Particles
ATM interactor
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-2363s1c1
Sequence:CCGGGCAACGAAACTCAGACAGCAACTCGAGTTGCTGTCTGAGTTTCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-1502s1c1
Sequence:CCGGCCAGTGGGATAGAAAGTCCAACTCGAGTTGGACTTTCTATCCCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015251.2-2314s1c1
Sequence:CCGGCAGACCATGAGTTCTGGGTTTCTCGAGAAACCCAGAACTCATGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015251.2-3018s1c1
Sequence:CCGGCGTCAGCTTTGACACCTCTTTCTCGAGAAAGAGGTGTCAAAGCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-866s1c1
Sequence:CCGGCTCTTACAACACCACCGAGATCTCGAGATCTCGGTGGTGTTGTAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-2039s1c1
Sequence:CCGGCGGACTTCTTACTCGCAGATACTCGAGTATCTGCGAGTAAGAAGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015251.2-4236s1c1
Sequence:CCGGGCCTGTATTACTGAAAGCTAACTCGAGTTAGCTTTCAGTAATACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015251.2-729s1c1
Sequence:CCGGGAAGTTATCCAACAAGACCATCTCGAGATGGTCTTGTTGGATAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015251.2-3844s1c1
Sequence:CCGGCCTTCCATTCACCATTCTTTACTCGAGTAAAGAATGGTGAATGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-2950s21c1
Sequence:GTACCGGGATGCTGCCACCGTAGGATTTCTCGAGAAATCCTACGGTGGCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-729s21c1
Sequence:CCGGGAAGTTATCCAACAAGACCATCTCGAGATGGTCTTGTTGGATAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-866s21c1
Sequence:CCGGCTCTTACAACACCACCGAGATCTCGAGATCTCGGTGGTGTTGTAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-2039s21c1
Sequence:CCGGCGGACTTCTTACTCGCAGATACTCGAGTATCTGCGAGTAAGAAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015251.2-1502s21c1
Sequence:CCGGCCAGTGGGATAGAAAGTCCAACTCGAGTTGGACTTTCTATCCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177700
VALIDATED
ATMIN MISSION shRNA Bacterial Glycerol Stock
ATM interactor
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177700.3-1127s1c1
Sequence:CCGGCCTGTTGTTGAGCCAATGAATCTCGAGATTCATTGGCTCAACAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177700.3-4646s1c1
Sequence:CCGGCGTGGCTCTTTGTAAATATAACTCGAGTTATATTTACAAAGAGCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177700.3-358s1c1
Sequence:CCGGCCCGACAATAAGGAAAGACTTCTCGAGAAGTCTTTCCTTATTGTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177700.3-1136s1c1
Sequence:CCGGGAGCCAATGAATACAGGTGTTCTCGAGAACACCTGTATTCATTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177700
VALIDATED
ATMIN MISSION shRNA shRNA Plasmid DNA
ATM interactor
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177700.3-1127s1c1
Sequence:CCGGCCTGTTGTTGAGCCAATGAATCTCGAGATTCATTGGCTCAACAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177700.3-4646s1c1
Sequence:CCGGCGTGGCTCTTTGTAAATATAACTCGAGTTATATTTACAAAGAGCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177700.3-358s1c1
Sequence:CCGGCCCGACAATAAGGAAAGACTTCTCGAGAAGTCTTTCCTTATTGTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177700.3-1136s1c1
Sequence:CCGGGAGCCAATGAATACAGGTGTTCTCGAGAACACCTGTATTCATTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177700
VALIDATED
ATMIN MISSION shRNA Lentiviral Transduction Particles
ATM interactor
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177700.3-1127s1c1
Sequence:CCGGCCTGTTGTTGAGCCAATGAATCTCGAGATTCATTGGCTCAACAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177700.3-4646s1c1
Sequence:CCGGCGTGGCTCTTTGTAAATATAACTCGAGTTATATTTACAAAGAGCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177700.3-358s1c1
Sequence:CCGGCCCGACAATAAGGAAAGACTTCTCGAGAAGTCTTTCCTTATTGTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177700.3-1136s1c1
Sequence:CCGGGAGCCAATGAATACAGGTGTTCTCGAGAACACCTGTATTCATTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)