EMAIL THIS PAGE TO A FRIEND

ATP10A

ATPase, class V, type 10A

96 Gene Product Result for
Synonyms: ATP10C ATPVA ATPVC
UniProtKB ID: O60312, Q969I4
Gene ID:
Human(57194) Summary: The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
Mouse(11982) ATPase, class V, type 10A
Rat(365266) ATPase, class V, type 10A
Zebrafish(567172) ATPase, class V, type 10A
cow(535967) ATPase, class V, type 10A
cow(510723) ATPase, class V, type 10A
Horse(100062211) ATPase, class V, type 10A
domestic cat(101093440) ATPase, class V, type 10A
dog(488691) ATPase, class V, type 10A
chicken(418685) ATPase, class V, type 10A
Zebrafish(563932) ATPase, class V, type 10A
sheep(101107997) ATPase, class V, type 10A
domestic guinea pig(100731067) ATPase, class V, type 10A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024490 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU057641 MISSION® esiRNA esiRNA targeting mouse Atp10a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024490 Rosetta Predictions human pricing
XM_001054901 Rosetta Predictions rat pricing
XM_001054957 Rosetta Predictions rat pricing
XM_344901 Rosetta Predictions rat pricing
NM_009728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356755 predicted 2546
2 SASI_Hs01_00219756 predicted 3460
3 SASI_Hs01_00219757 predicted 622
4 SASI_Hs01_00219758 predicted 598
5 SASI_Hs01_00219759 predicted 1988
6 SASI_Hs01_00219760 predicted 2839
7 SASI_Hs01_00219761 predicted 3229
8 SASI_Hs01_00219762 predicted 3280
9 SASI_Hs01_00219763 predicted 3537
10 SASI_Hs01_00219764 predicted 2319
11 SASI_Hs01_00219765 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277672 predicted 3796
2 SASI_Rn02_00277673 predicted 2608
3 SASI_Rn02_00277674 predicted 1219
4 SASI_Rn02_00277675 predicted 1752
5 SASI_Rn02_00277676 predicted 4756
6 SASI_Rn02_00277677 predicted 4672
7 SASI_Rn02_00277678 predicted 3501
8 SASI_Rn02_00277679 predicted 3594
9 SASI_Rn02_00277680 predicted 944
10 SASI_Rn02_00277681 predicted 3046
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277822 predicted 3796
2 SASI_Rn02_00277823 predicted 2602
3 SASI_Rn02_00277824 predicted 1222
4 SASI_Rn02_00277825 predicted 1748
5 SASI_Rn02_00277826 predicted 4747
6 SASI_Rn02_00277827 predicted 4665
7 SASI_Rn02_00277828 predicted 3498
8 SASI_Rn02_00277829 predicted 3586
9 SASI_Rn02_00277830 predicted 943
10 SASI_Rn02_00277831 predicted 3043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397736 predicted 1222
2 SASI_Rn02_00397737 predicted 922
3 SASI_Rn02_00397738 predicted 1296
4 SASI_Rn02_00397739 predicted 1515
5 SASI_Rn02_00397740 predicted 1745
6 SASI_Rn02_00397741 predicted 1604
7 SASI_Rn02_00397742 predicted 1287
8 SASI_Rn02_00397743 predicted 789
9 SASI_Rn02_00397744 predicted 1436
10 SASI_Rn02_00397745 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097563 predicted 1506
2 SASI_Mm01_00097565 predicted 4146
3 SASI_Mm02_00316888 predicted 785
4 SASI_Mm01_00097566 predicted 1640
5 SASI_Mm02_00316889 predicted 4059
6 SASI_Mm01_00097567 predicted 3793
7 SASI_Mm01_00097568 predicted 3086
8 SASI_Mm01_00097569 predicted 2781
9 SASI_Mm01_00097570 predicted 3634
10 SASI_Mm01_00097571 predicted 1279
11 SASI_Mm01_00097562 predicted 1086
12 SASI_Mm01_00097564 predicted 3451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024490
VALIDATED
ATP10A MISSION shRNA Bacterial Glycerol Stock
ATPase, class V, type 10A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024490.2-931s1c1
Sequence:CCGGCGGCTGCATCATACATGACAACTCGAGTTGTCATGTATGATGCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024490.2-4662s1c1
Sequence:CCGGGACTACTTATAGGAGCATCTTCTCGAGAAGATGCTCCTATAAGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024490.2-2639s1c1
Sequence:CCGGGCCAAGAGAGTTCTGAGTAAACTCGAGTTTACTCAGAACTCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024490.2-3556s1c1
Sequence:CCGGCCAGTGGTATCTAATCTTCTTCTCGAGAAGAAGATTAGATACCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-1448s21c1
Sequence:CCGGGAATATTCTCATGATGCAAATCTCGAGATTTGCATCATGAGAATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024490.3-3608s21c1
Sequence:CCGGCCACGAACGTTCTGGTTTAACCTCGAGGTTAAACCAGAACGTTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-1294s21c1
Sequence:CCGGGCAGTTGTATGACGAAGAAACCTCGAGGTTTCTTCGTCATACAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024490.3-2712s21c1
Sequence:CCGGACGGAGTCCCTGAAACTATTTCTCGAGAAATAGTTTCAGGGACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024490.3-4915s21c1
Sequence:CCGGGACTGCGCACTGAGTACAAATCTCGAGATTTGTACTCAGTGCGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024490.3-4559s21c1
Sequence:CCGGCCAGACCACAGACTACTTATACTCGAGTATAAGTAGTCTGTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-613s21c1
Sequence:CCGGGCGTCTTCGCTGCAACGAAATCTCGAGATTTCGTTGCAGCGAAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-3285s21c1
Sequence:CCGGGCGACTTTGCAGTGCCGAAATCTCGAGATTTCGGCACTGCAAAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024490
VALIDATED
ATP10A MISSION shRNA shRNA Plasmid DNA
ATPase, class V, type 10A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024490.2-931s1c1
Sequence:CCGGCGGCTGCATCATACATGACAACTCGAGTTGTCATGTATGATGCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024490.2-4662s1c1
Sequence:CCGGGACTACTTATAGGAGCATCTTCTCGAGAAGATGCTCCTATAAGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024490.2-2639s1c1
Sequence:CCGGGCCAAGAGAGTTCTGAGTAAACTCGAGTTTACTCAGAACTCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024490.2-3556s1c1
Sequence:CCGGCCAGTGGTATCTAATCTTCTTCTCGAGAAGAAGATTAGATACCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-1448s21c1
Sequence:CCGGGAATATTCTCATGATGCAAATCTCGAGATTTGCATCATGAGAATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024490.3-3608s21c1
Sequence:CCGGCCACGAACGTTCTGGTTTAACCTCGAGGTTAAACCAGAACGTTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-1294s21c1
Sequence:CCGGGCAGTTGTATGACGAAGAAACCTCGAGGTTTCTTCGTCATACAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024490.3-2712s21c1
Sequence:CCGGACGGAGTCCCTGAAACTATTTCTCGAGAAATAGTTTCAGGGACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024490.3-4915s21c1
Sequence:CCGGGACTGCGCACTGAGTACAAATCTCGAGATTTGTACTCAGTGCGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024490.3-4559s21c1
Sequence:CCGGCCAGACCACAGACTACTTATACTCGAGTATAAGTAGTCTGTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-613s21c1
Sequence:CCGGGCGTCTTCGCTGCAACGAAATCTCGAGATTTCGTTGCAGCGAAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-3285s21c1
Sequence:CCGGGCGACTTTGCAGTGCCGAAATCTCGAGATTTCGGCACTGCAAAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024490
VALIDATED
ATP10A MISSION shRNA Lentiviral Transduction Particles
ATPase, class V, type 10A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024490.2-931s1c1
Sequence:CCGGCGGCTGCATCATACATGACAACTCGAGTTGTCATGTATGATGCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024490.2-4662s1c1
Sequence:CCGGGACTACTTATAGGAGCATCTTCTCGAGAAGATGCTCCTATAAGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024490.2-2639s1c1
Sequence:CCGGGCCAAGAGAGTTCTGAGTAAACTCGAGTTTACTCAGAACTCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024490.2-3556s1c1
Sequence:CCGGCCAGTGGTATCTAATCTTCTTCTCGAGAAGAAGATTAGATACCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-1448s21c1
Sequence:CCGGGAATATTCTCATGATGCAAATCTCGAGATTTGCATCATGAGAATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024490.3-3608s21c1
Sequence:CCGGCCACGAACGTTCTGGTTTAACCTCGAGGTTAAACCAGAACGTTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-1294s21c1
Sequence:CCGGGCAGTTGTATGACGAAGAAACCTCGAGGTTTCTTCGTCATACAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024490.3-2712s21c1
Sequence:CCGGACGGAGTCCCTGAAACTATTTCTCGAGAAATAGTTTCAGGGACTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024490.3-4915s21c1
Sequence:CCGGGACTGCGCACTGAGTACAAATCTCGAGATTTGTACTCAGTGCGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024490.3-4559s21c1
Sequence:CCGGCCAGACCACAGACTACTTATACTCGAGTATAAGTAGTCTGTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-613s21c1
Sequence:CCGGGCGTCTTCGCTGCAACGAAATCTCGAGATTTCGTTGCAGCGAAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024490.3-3285s21c1
Sequence:CCGGGCGACTTTGCAGTGCCGAAATCTCGAGATTTCGGCACTGCAAAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009728
VALIDATED
ATP10A MISSION shRNA Bacterial Glycerol Stock
ATPase, class V, type 10A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-1422s1c1
Sequence:CCGGCGGCACATTAACTGAGAACAACTCGAGTTGTTCTCAGTTAATGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-1083s1c1
Sequence:CCGGCCTCGTTTGTATATCTCTATTCTCGAGAATAGAGATATACAAACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-4296s1c1
Sequence:CCGGAGTGGATACAAACATGCCATTCTCGAGAATGGCATGTTTGTATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-2036s1c1
Sequence:CCGGGCCACAAATCTGGATCAGCTTCTCGAGAAGCTGATCCAGATTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-4005s1c1
Sequence:CCGGCGCACCTATTGCTGCATTGTTCTCGAGAACAATGCAGCAATAGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-1213s21c1
Sequence:CCGGCCTCGTTTGTATATCTCTATTCTCGAGAATAGAGATATACAAACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-1552s21c1
Sequence:CCGGCGGCACATTAACTGAGAACAACTCGAGTTGTTCTCAGTTAATGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-4135s21c1
Sequence:CCGGCGCACCTATTGCTGCATTGTTCTCGAGAACAATGCAGCAATAGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-4426s21c1
Sequence:CCGGAGTGGATACAAACATGCCATTCTCGAGAATGGCATGTTTGTATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009728
VALIDATED
ATP10A MISSION shRNA shRNA Plasmid DNA
ATPase, class V, type 10A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-1422s1c1
Sequence:CCGGCGGCACATTAACTGAGAACAACTCGAGTTGTTCTCAGTTAATGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-1083s1c1
Sequence:CCGGCCTCGTTTGTATATCTCTATTCTCGAGAATAGAGATATACAAACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-4296s1c1
Sequence:CCGGAGTGGATACAAACATGCCATTCTCGAGAATGGCATGTTTGTATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-2036s1c1
Sequence:CCGGGCCACAAATCTGGATCAGCTTCTCGAGAAGCTGATCCAGATTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-4005s1c1
Sequence:CCGGCGCACCTATTGCTGCATTGTTCTCGAGAACAATGCAGCAATAGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-1213s21c1
Sequence:CCGGCCTCGTTTGTATATCTCTATTCTCGAGAATAGAGATATACAAACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-1552s21c1
Sequence:CCGGCGGCACATTAACTGAGAACAACTCGAGTTGTTCTCAGTTAATGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-4135s21c1
Sequence:CCGGCGCACCTATTGCTGCATTGTTCTCGAGAACAATGCAGCAATAGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-4426s21c1
Sequence:CCGGAGTGGATACAAACATGCCATTCTCGAGAATGGCATGTTTGTATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009728
VALIDATED
ATP10A MISSION shRNA Lentiviral Transduction Particles
ATPase, class V, type 10A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-1422s1c1
Sequence:CCGGCGGCACATTAACTGAGAACAACTCGAGTTGTTCTCAGTTAATGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-1083s1c1
Sequence:CCGGCCTCGTTTGTATATCTCTATTCTCGAGAATAGAGATATACAAACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-4296s1c1
Sequence:CCGGAGTGGATACAAACATGCCATTCTCGAGAATGGCATGTTTGTATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-2036s1c1
Sequence:CCGGGCCACAAATCTGGATCAGCTTCTCGAGAAGCTGATCCAGATTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009728.1-4005s1c1
Sequence:CCGGCGCACCTATTGCTGCATTGTTCTCGAGAACAATGCAGCAATAGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-1213s21c1
Sequence:CCGGCCTCGTTTGTATATCTCTATTCTCGAGAATAGAGATATACAAACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-1552s21c1
Sequence:CCGGCGGCACATTAACTGAGAACAACTCGAGTTGTTCTCAGTTAATGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-4135s21c1
Sequence:CCGGCGCACCTATTGCTGCATTGTTCTCGAGAACAATGCAGCAATAGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009728.2-4426s21c1
Sequence:CCGGAGTGGATACAAACATGCCATTCTCGAGAATGGCATGTTTGTATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)