EMAIL THIS PAGE TO A FRIEND

ATP13A1

ATPase type 13A1

56 Gene Product Result for
Synonyms: ATP13A
UniProtKB ID: Q9HD20, B3KPJ2, B3KTA7, Q9H6C6
Gene ID:
Mouse(170759) ATPase type 13A1
Rat(290673) ATPase type 13A1
chicken(426090) ATPase type 13A1
domestic cat(101101622) ATPase type 13A1
Horse(100071205) ATPase type 13A1
cow(534369) ATPase type 13A1
dog(476658) ATPase type 13A1
naked mole-rat(101724094) ATPase type 13A1
sheep(101103810) ATPase type 13A1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020410 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020410 Rosetta Predictions human pricing
NM_001106079 Rosetta Predictions rat pricing
NM_133224 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232297 predicted 3045
2 SASI_Hs01_00232298 predicted 1445
3 SASI_Hs01_00232300 predicted 1153
4 SASI_Hs01_00232301 predicted 1832
5 SASI_Hs01_00232302 predicted 2248
6 SASI_Hs01_00232303 predicted 3443
7 SASI_Hs01_00232304 predicted 2163
8 SASI_Hs01_00232305 predicted 2155
9 SASI_Hs01_00232306 predicted 2916
10 SASI_Hs02_00353412 predicted 658
11 SASI_Hs01_00232299 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215422 predicted 3000
2 SASI_Rn02_00215423 predicted 1791
3 SASI_Rn02_00215424 predicted 1252
4 SASI_Rn02_00215425 predicted 1229
5 SASI_Rn02_00215426 predicted 1043
6 SASI_Rn02_00215427 predicted 2163
7 SASI_Rn02_00215428 predicted 1567
8 SASI_Rn02_00215429 predicted 2046
9 SASI_Rn02_00215430 predicted 1454
10 SASI_Rn02_00215431 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023629 predicted 1425
2 SASI_Mm01_00023630 predicted 1818
3 SASI_Mm01_00023631 predicted 1742
4 SASI_Mm01_00023632 predicted 2075
5 SASI_Mm01_00023633 predicted 681
6 SASI_Mm01_00023634 predicted 2534
7 SASI_Mm01_00023635 predicted 1073
8 SASI_Mm01_00023636 predicted 1477
9 SASI_Mm01_00023637 predicted 782
10 SASI_Mm01_00023638 predicted 1486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020410
ATP13A1 MISSION shRNA Bacterial Glycerol Stock
ATPase type 13A1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020410.2-813s21c1
Sequence:CCGGACTGGTACTACAGCGTCTTTACTCGAGTAAAGACGCTGTAGTACCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020410.2-618s21c1
Sequence:CCGGGAAACGCCTTCTCATACTATCCTCGAGGATAGTATGAGAAGGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020410.2-2859s21c1
Sequence:CCGGAGAGTACGCCCATTGTGAAACCTCGAGGTTTCACAATGGGCGTACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-1021s1c1
Sequence:CCGGGCTGCCTATGTATGGATTGAACTCGAGTTCAATCCATACATAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-2908s1c1
Sequence:CCGGGTGGACTTGTACAAGGAGTTTCTCGAGAAACTCCTTGTACAAGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-1783s1c1
Sequence:CCGGCTCAAGTTCGTCGGCTTCATTCTCGAGAATGAAGCCGACGAACTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-1450s1c1
Sequence:CCGGCTGACCAAAGATGAGAAAGTACTCGAGTACTTTCTCATCTTTGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-168s1c1
Sequence:CCGGCCAGAAGATCAAGTATTCCTACTCGAGTAGGAATACTTGATCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020410
ATP13A1 MISSION shRNA shRNA Plasmid DNA
ATPase type 13A1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020410.2-813s21c1
Sequence:CCGGACTGGTACTACAGCGTCTTTACTCGAGTAAAGACGCTGTAGTACCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020410.2-618s21c1
Sequence:CCGGGAAACGCCTTCTCATACTATCCTCGAGGATAGTATGAGAAGGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020410.2-2859s21c1
Sequence:CCGGAGAGTACGCCCATTGTGAAACCTCGAGGTTTCACAATGGGCGTACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-1021s1c1
Sequence:CCGGGCTGCCTATGTATGGATTGAACTCGAGTTCAATCCATACATAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-2908s1c1
Sequence:CCGGGTGGACTTGTACAAGGAGTTTCTCGAGAAACTCCTTGTACAAGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-1783s1c1
Sequence:CCGGCTCAAGTTCGTCGGCTTCATTCTCGAGAATGAAGCCGACGAACTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-1450s1c1
Sequence:CCGGCTGACCAAAGATGAGAAAGTACTCGAGTACTTTCTCATCTTTGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-168s1c1
Sequence:CCGGCCAGAAGATCAAGTATTCCTACTCGAGTAGGAATACTTGATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020410
ATP13A1 MISSION shRNA Lentiviral Transduction Particles
ATPase type 13A1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020410.2-813s21c1
Sequence:CCGGACTGGTACTACAGCGTCTTTACTCGAGTAAAGACGCTGTAGTACCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020410.2-618s21c1
Sequence:CCGGGAAACGCCTTCTCATACTATCCTCGAGGATAGTATGAGAAGGCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020410.2-2859s21c1
Sequence:CCGGAGAGTACGCCCATTGTGAAACCTCGAGGTTTCACAATGGGCGTACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-1021s1c1
Sequence:CCGGGCTGCCTATGTATGGATTGAACTCGAGTTCAATCCATACATAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-2908s1c1
Sequence:CCGGGTGGACTTGTACAAGGAGTTTCTCGAGAAACTCCTTGTACAAGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-1783s1c1
Sequence:CCGGCTCAAGTTCGTCGGCTTCATTCTCGAGAATGAAGCCGACGAACTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-1450s1c1
Sequence:CCGGCTGACCAAAGATGAGAAAGTACTCGAGTACTTTCTCATCTTTGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020410.1-168s1c1
Sequence:CCGGCCAGAAGATCAAGTATTCCTACTCGAGTAGGAATACTTGATCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133224
VALIDATED
ATP13A1 MISSION shRNA Bacterial Glycerol Stock
ATPase type 13A1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-3625s21c1
Sequence:CCGGGAAGATGGTGCTGGTATCCACCTCGAGGTGGATACCAGCACCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133224.1-3186s21c1
Sequence:CCGGGCTGCAATTCTCTGTCCACTTCTCGAGAAGTGGACAGAGAATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-1282s21c1
Sequence:CCGGGGCAGACTACTGCGTACAATTCTCGAGAATTGTACGCAGTAGTCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-3655s21c1
Sequence:CCGGTGGCTGCCACTGAACAGGAAACTCGAGTTTCCTGTTCAGTGGCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-2148s21c1
Sequence:CCGGCCTCAAGTTTGTGGGCTTCATCTCGAGATGAAGCCCACAAACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-2358s21c1
Sequence:CCGGTGAGTGGCGCTCCATTGATAGCTCGAGCTATCAATGGAGCGCCACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-406s1c1
Sequence:CCGGCCGGAGTATGATCCCAACAAACTCGAGTTTGTTGGGATCATACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133224.1-2148s1c1
Sequence:CCGGCCTCAAGTTTGTGGGCTTCATCTCGAGATGAAGCCCACAAACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-1426s1c1
Sequence:CCGGCGGAACCGTTACAAGCTCTTTCTCGAGAAAGAGCTTGTAACGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-3186s1c1
Sequence:CCGGGCTGCAATTCTCTGTCCACTTCTCGAGAAGTGGACAGAGAATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-2574s1c1
Sequence:CCGGGCTGGGTTATGTGACCCTTATCTCGAGATAAGGGTCACATAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133224
VALIDATED
ATP13A1 MISSION shRNA shRNA Plasmid DNA
ATPase type 13A1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-3625s21c1
Sequence:CCGGGAAGATGGTGCTGGTATCCACCTCGAGGTGGATACCAGCACCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133224.1-3186s21c1
Sequence:CCGGGCTGCAATTCTCTGTCCACTTCTCGAGAAGTGGACAGAGAATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-1282s21c1
Sequence:CCGGGGCAGACTACTGCGTACAATTCTCGAGAATTGTACGCAGTAGTCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-3655s21c1
Sequence:CCGGTGGCTGCCACTGAACAGGAAACTCGAGTTTCCTGTTCAGTGGCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-2148s21c1
Sequence:CCGGCCTCAAGTTTGTGGGCTTCATCTCGAGATGAAGCCCACAAACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-2358s21c1
Sequence:CCGGTGAGTGGCGCTCCATTGATAGCTCGAGCTATCAATGGAGCGCCACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-406s1c1
Sequence:CCGGCCGGAGTATGATCCCAACAAACTCGAGTTTGTTGGGATCATACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133224.1-2148s1c1
Sequence:CCGGCCTCAAGTTTGTGGGCTTCATCTCGAGATGAAGCCCACAAACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-1426s1c1
Sequence:CCGGCGGAACCGTTACAAGCTCTTTCTCGAGAAAGAGCTTGTAACGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-3186s1c1
Sequence:CCGGGCTGCAATTCTCTGTCCACTTCTCGAGAAGTGGACAGAGAATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-2574s1c1
Sequence:CCGGGCTGGGTTATGTGACCCTTATCTCGAGATAAGGGTCACATAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133224
VALIDATED
ATP13A1 MISSION shRNA Lentiviral Transduction Particles
ATPase type 13A1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-3625s21c1
Sequence:CCGGGAAGATGGTGCTGGTATCCACCTCGAGGTGGATACCAGCACCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133224.1-3186s21c1
Sequence:CCGGGCTGCAATTCTCTGTCCACTTCTCGAGAAGTGGACAGAGAATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-1282s21c1
Sequence:CCGGGGCAGACTACTGCGTACAATTCTCGAGAATTGTACGCAGTAGTCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-3655s21c1
Sequence:CCGGTGGCTGCCACTGAACAGGAAACTCGAGTTTCCTGTTCAGTGGCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-2148s21c1
Sequence:CCGGCCTCAAGTTTGTGGGCTTCATCTCGAGATGAAGCCCACAAACTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133224.1-2358s21c1
Sequence:CCGGTGAGTGGCGCTCCATTGATAGCTCGAGCTATCAATGGAGCGCCACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-406s1c1
Sequence:CCGGCCGGAGTATGATCCCAACAAACTCGAGTTTGTTGGGATCATACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133224.1-2148s1c1
Sequence:CCGGCCTCAAGTTTGTGGGCTTCATCTCGAGATGAAGCCCACAAACTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-1426s1c1
Sequence:CCGGCGGAACCGTTACAAGCTCTTTCTCGAGAAAGAGCTTGTAACGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-3186s1c1
Sequence:CCGGGCTGCAATTCTCTGTCCACTTCTCGAGAAGTGGACAGAGAATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133224.1-2574s1c1
Sequence:CCGGGCTGGGTTATGTGACCCTTATCTCGAGATAAGGGTCACATAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)