EMAIL THIS PAGE TO A FRIEND

ATP1A4

ATPase, Na+/K+ transporting, alpha 4 polypeptide

99 Gene Product Result for
Synonyms: ATP1A1 ATP1AL2
Gene ID:
Human(480) Summary: The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(27222) ATPase, Na+/K+ transporting, alpha 4 polypeptide
Rat(29132) ATPase, Na+/K+ transporting, alpha 4 polypeptide
dog(488637) ATPase, Na+/K+ transporting, alpha 4 polypeptide
domestic cat(101096375) ATPase, Na+/K+ transporting, alpha 4 polypeptide
cow(537960) ATPase, Na+/K+ transporting, alpha 4 polypeptide
Horse(100058301) ATPase, Na+/K+ transporting, alpha 4 polypeptide
domestic guinea pig(100729796) ATPase, Na+/K+ transporting, alpha 4 polypeptide
naked mole-rat(101721060) ATPase, Na+/K+ transporting, alpha 4 polypeptide
sheep(101118398) ATPase, Na+/K+ transporting, alpha 4 polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144699 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014751 MISSION® esiRNA esiRNA targeting human ATP1A4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001734 Rosetta Predictions human pricing
NM_144699 Rosetta Predictions human pricing
NM_022848 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116815 predicted 461
2 SASI_Hs01_00116816 predicted 523
3 SASI_Hs01_00116817 predicted 416
4 SASI_Hs01_00116818 predicted 468
5 SASI_Hs01_00116819 predicted 465
6 SASI_Hs01_00116820 predicted 372
7 SASI_Hs01_00116821 predicted 501
8 SASI_Hs01_00116822 predicted 412
9 SASI_Hs02_00303922 predicted 392
10 SASI_Hs01_00116823 predicted 494
11 SASI_Hs01_00116824 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172123 predicted 3424
2 SASI_Hs01_00172124 predicted 3491
3 SASI_Hs01_00172125 predicted 3372
4 SASI_Hs01_00172126 predicted 3432
5 SASI_Hs01_00172127 predicted 3425
6 SASI_Hs01_00172128 predicted 3333
7 SASI_Hs01_00172129 predicted 3463
8 SASI_Hs01_00172130 predicted 3368
9 SASI_Hs02_00364625 predicted 3353
10 SASI_Hs01_00172131 predicted 3454
11 SASI_Hs01_00172132 predicted 3553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088668 predicted 212
2 SASI_Rn01_00088669 predicted 2528
3 SASI_Rn01_00088670 predicted 3196
4 SASI_Rn01_00088673 predicted 2073
5 SASI_Rn02_00263562 predicted 3167
6 SASI_Rn02_00263563 predicted 3179
7 SASI_Rn01_00088674 predicted 1497
8 SASI_Rn02_00263564 predicted 564
9 SASI_Rn01_00088675 predicted 449
10 SASI_Rn01_00088676 predicted 718
11 SASI_Rn01_00088671 predicted 2098
12 SASI_Rn01_00088672 predicted 2634
13 SASI_Rn01_00088677 predicted 2866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144699
ATP1A4 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, alpha 4 polypeptide
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144699.3-1000s21c1
Sequence:CCGGCTCAGCAAGCTCTGGTAATTCCTCGAGGAATTACCAGAGCTTGCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144699.3-1678s21c1
Sequence:CCGGGGTTTGATATGACCGTGTATGCTCGAGCATACACGGTCATATCAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144699.3-3481s21c1
Sequence:CCGGGTATTCTCATCTTCGTCTATGCTCGAGCATAGACGAAGATGAGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-3079s1c1
Sequence:CCGGGCTGGATTCTTTACCTACTTTCTCGAGAAAGTAGGTAAAGAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-2073s1c1
Sequence:CCGGGTACTCAATGAACGATGAAATCTCGAGATTTCATCGTTCATTGAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-3423s1c1
Sequence:CCGGGCGAATGTACCCACTCAAGATCTCGAGATCTTGAGTGGGTACATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-749s1c1
Sequence:CCGGCCACTCCAGAATGGGTCAAATCTCGAGATTTGACCCATTCTGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144699
ATP1A4 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, alpha 4 polypeptide
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144699.3-1000s21c1
Sequence:CCGGCTCAGCAAGCTCTGGTAATTCCTCGAGGAATTACCAGAGCTTGCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144699.3-1678s21c1
Sequence:CCGGGGTTTGATATGACCGTGTATGCTCGAGCATACACGGTCATATCAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144699.3-3481s21c1
Sequence:CCGGGTATTCTCATCTTCGTCTATGCTCGAGCATAGACGAAGATGAGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-3079s1c1
Sequence:CCGGGCTGGATTCTTTACCTACTTTCTCGAGAAAGTAGGTAAAGAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-2073s1c1
Sequence:CCGGGTACTCAATGAACGATGAAATCTCGAGATTTCATCGTTCATTGAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-3423s1c1
Sequence:CCGGGCGAATGTACCCACTCAAGATCTCGAGATCTTGAGTGGGTACATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-749s1c1
Sequence:CCGGCCACTCCAGAATGGGTCAAATCTCGAGATTTGACCCATTCTGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144699
ATP1A4 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, alpha 4 polypeptide
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144699.3-1000s21c1
Sequence:CCGGCTCAGCAAGCTCTGGTAATTCCTCGAGGAATTACCAGAGCTTGCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144699.3-1678s21c1
Sequence:CCGGGGTTTGATATGACCGTGTATGCTCGAGCATACACGGTCATATCAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144699.3-3481s21c1
Sequence:CCGGGTATTCTCATCTTCGTCTATGCTCGAGCATAGACGAAGATGAGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-3079s1c1
Sequence:CCGGGCTGGATTCTTTACCTACTTTCTCGAGAAAGTAGGTAAAGAATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-2073s1c1
Sequence:CCGGGTACTCAATGAACGATGAAATCTCGAGATTTCATCGTTCATTGAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-3423s1c1
Sequence:CCGGGCGAATGTACCCACTCAAGATCTCGAGATCTTGAGTGGGTACATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144699.1-749s1c1
Sequence:CCGGCCACTCCAGAATGGGTCAAATCTCGAGATTTGACCCATTCTGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)