EMAIL THIS PAGE TO A FRIEND

ATP4A

ATPase, H+/K+ exchanging, alpha polypeptide

59 Gene Product Result for
Synonyms: ATP6A
UniProtKB ID: P20648, O00738
Gene ID:
Human(495) Summary: The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
Mouse(11944) ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Rat(24216) ATPase, H+/K+ exchanging, alpha polypeptide
dog(431686) ATPase, H+/K+ exchanging, alpha polypeptide
cow(521163) ATPase, H+/K+ exchanging, alpha polypeptide
domestic cat(101100771) ATPase, H+/K+ exchanging, alpha polypeptide
naked mole-rat(101724247) ATPase, H+/K+ exchanging, alpha polypeptide
domestic guinea pig(100732743) ATPase, H+/K+ exchanging, alpha polypeptide
sheep(101116166) ATPase, H+/K+ exchanging, alpha polypeptide
Domestic Rabbit(100009279) ATPase, H+/K+ exchanging, alpha polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000704 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000704 Rosetta Predictions human pricing
XM_001076500 Rosetta Predictions rat pricing
XM_341834 Rosetta Predictions rat pricing
NM_018731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096824 predicted 563
2 SASI_Hs01_00096825 predicted 3213
3 SASI_Hs01_00096826 predicted 1113
4 SASI_Hs01_00096827 predicted 909
5 SASI_Hs01_00096828 predicted 1808
6 SASI_Hs01_00096829 predicted 1148
7 SASI_Hs01_00096830 predicted 496
8 SASI_Hs01_00096831 predicted 2514
9 SASI_Hs01_00096833 predicted 1281
10 SASI_Hs02_00303106 predicted 3217
11 SASI_Hs01_00096832 predicted 2913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353487 predicted 557
2 SASI_Rn02_00353488 predicted 2707
3 SASI_Rn02_00353489 predicted 1159
4 SASI_Rn02_00353490 predicted 2204
5 SASI_Rn02_00353491 predicted 2461
6 SASI_Rn02_00353492 predicted 460
7 SASI_Rn02_00353493 predicted 1068
8 SASI_Rn02_00353494 predicted 2262
9 SASI_Rn02_00353495 predicted 354
10 SASI_Rn02_00353496 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393423 predicted 2445
2 SASI_Rn02_00393424 predicted 566
3 SASI_Rn02_00393425 predicted 2703
4 SASI_Rn02_00393426 predicted 1164
5 SASI_Rn02_00393427 predicted 2463
6 SASI_Rn02_00393428 predicted 464
7 SASI_Rn02_00393429 predicted 1063
8 SASI_Rn02_00393430 predicted 2265
9 SASI_Rn02_00393431 predicted 356
10 SASI_Rn02_00393432 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323961 predicted 3080
2 SASI_Mm01_00032443 predicted 2700
3 SASI_Mm02_00323962 predicted 3095
4 SASI_Mm01_00032444 predicted 580
5 SASI_Mm01_00032445 predicted 2196
6 SASI_Mm01_00032446 predicted 2866
7 SASI_Mm01_00032448 predicted 482
8 SASI_Mm01_00032449 predicted 2579
9 SASI_Mm01_00032450 predicted 1940
10 SASI_Mm01_00032451 predicted 1188
11 SASI_Mm01_00032447 predicted 2271
12 SASI_Mm01_00032452 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000704
ATP4A MISSION shRNA Bacterial Glycerol Stock
ATPase, H+/K+ exchanging, alpha polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-454s21c1
Sequence:CCGGACCTGGCAATCGCTCTCATTGCTCGAGCAATGAGAGCGATTGCCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-526s21c1
Sequence:CCGGCCAACATCATCGCCAGCTTTACTCGAGTAAAGCTGGCGATGATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-2371s21c1
Sequence:CCGGACAACCTGAAGAAGTCTATTGCTCGAGCAATAGACTTCTTCAGGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-2491s21c1
Sequence:CCGGTCGAACTCTGCACTGACATTTCTCGAGAAATGTCAGTGCAGAGTTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-2614s1c1
Sequence:CCGGGCCTACTCCTACTTCCAGATTCTCGAGAATCTGGAAGTAGGAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-1819s1c1
Sequence:CCGGGCGGGACTTGTATCCATGATTCTCGAGAATCATGGATACAAGTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-915s1c1
Sequence:CCGGCGCTATCGAGATCGAGCATTTCTCGAGAAATGCTCGATCTCGATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-2901s1c1
Sequence:CCGGGCAAGGCTTCTTCAGGAATAACTCGAGTTATTCCTGAAGAAGCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000704
ATP4A MISSION shRNA shRNA Plasmid DNA
ATPase, H+/K+ exchanging, alpha polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-454s21c1
Sequence:CCGGACCTGGCAATCGCTCTCATTGCTCGAGCAATGAGAGCGATTGCCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-526s21c1
Sequence:CCGGCCAACATCATCGCCAGCTTTACTCGAGTAAAGCTGGCGATGATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-2371s21c1
Sequence:CCGGACAACCTGAAGAAGTCTATTGCTCGAGCAATAGACTTCTTCAGGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-2491s21c1
Sequence:CCGGTCGAACTCTGCACTGACATTTCTCGAGAAATGTCAGTGCAGAGTTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-2614s1c1
Sequence:CCGGGCCTACTCCTACTTCCAGATTCTCGAGAATCTGGAAGTAGGAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-1819s1c1
Sequence:CCGGGCGGGACTTGTATCCATGATTCTCGAGAATCATGGATACAAGTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-915s1c1
Sequence:CCGGCGCTATCGAGATCGAGCATTTCTCGAGAAATGCTCGATCTCGATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-2901s1c1
Sequence:CCGGGCAAGGCTTCTTCAGGAATAACTCGAGTTATTCCTGAAGAAGCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000704
ATP4A MISSION shRNA Lentiviral Transduction Particles
ATPase, H+/K+ exchanging, alpha polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-454s21c1
Sequence:CCGGACCTGGCAATCGCTCTCATTGCTCGAGCAATGAGAGCGATTGCCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-526s21c1
Sequence:CCGGCCAACATCATCGCCAGCTTTACTCGAGTAAAGCTGGCGATGATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-2371s21c1
Sequence:CCGGACAACCTGAAGAAGTCTATTGCTCGAGCAATAGACTTCTTCAGGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000704.2-2491s21c1
Sequence:CCGGTCGAACTCTGCACTGACATTTCTCGAGAAATGTCAGTGCAGAGTTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-2614s1c1
Sequence:CCGGGCCTACTCCTACTTCCAGATTCTCGAGAATCTGGAAGTAGGAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-1819s1c1
Sequence:CCGGGCGGGACTTGTATCCATGATTCTCGAGAATCATGGATACAAGTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-915s1c1
Sequence:CCGGCGCTATCGAGATCGAGCATTTCTCGAGAAATGCTCGATCTCGATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000704.1-2901s1c1
Sequence:CCGGGCAAGGCTTCTTCAGGAATAACTCGAGTTATTCCTGAAGAAGCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018731
ATP4A MISSION shRNA Bacterial Glycerol Stock
ATPase, H+/K+ exchanging, alpha polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-2583s1c1
Sequence:CCGGCCTGGCTGCTTATTCCTATTTCTCGAGAAATAGGAATAAGCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-1137s1c1
Sequence:CCGGCCTAGGTTCTACATCAGTCATCTCGAGATGACTGATGTAGAACCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-2877s1c1
Sequence:CCGGGCAGGGATTCTTCAGGAACAACTCGAGTTGTTCCTGAAGAATCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-2784s1c1
Sequence:CCGGGTACACCTGTTACACCGTGTTCTCGAGAACACGGTGTAACAGGTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-886s1c1
Sequence:CCGGCCGATTGCAATCGAGATTGAACTCGAGTTCAATCTCGATTGCAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018731
ATP4A MISSION shRNA shRNA Plasmid DNA
ATPase, H+/K+ exchanging, alpha polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-2583s1c1
Sequence:CCGGCCTGGCTGCTTATTCCTATTTCTCGAGAAATAGGAATAAGCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-1137s1c1
Sequence:CCGGCCTAGGTTCTACATCAGTCATCTCGAGATGACTGATGTAGAACCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-2877s1c1
Sequence:CCGGGCAGGGATTCTTCAGGAACAACTCGAGTTGTTCCTGAAGAATCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-2784s1c1
Sequence:CCGGGTACACCTGTTACACCGTGTTCTCGAGAACACGGTGTAACAGGTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-886s1c1
Sequence:CCGGCCGATTGCAATCGAGATTGAACTCGAGTTCAATCTCGATTGCAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018731
ATP4A MISSION shRNA Lentiviral Transduction Particles
ATPase, H+/K+ exchanging, alpha polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-2583s1c1
Sequence:CCGGCCTGGCTGCTTATTCCTATTTCTCGAGAAATAGGAATAAGCAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-1137s1c1
Sequence:CCGGCCTAGGTTCTACATCAGTCATCTCGAGATGACTGATGTAGAACCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-2877s1c1
Sequence:CCGGGCAGGGATTCTTCAGGAACAACTCGAGTTGTTCCTGAAGAATCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-2784s1c1
Sequence:CCGGGTACACCTGTTACACCGTGTTCTCGAGAACACGGTGTAACAGGTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018731.1-886s1c1
Sequence:CCGGCCGATTGCAATCGAGATTGAACTCGAGTTCAATCTCGATTGCAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)