ATP5B

ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

75 Gene Product Result for

Synonyms: ATPMB ATPSB

Species: Human ATP5B(506), Mouse Atp5b(11947), Rat Atp5b(171374), Zebrafish atp5b(554135), cow ATP5B(327675), Horse ATP5B(100059825), domestic cat ATP5B(101087245), dog ATP5B(403669), chicken ATP5B(426673), sheep ATP5B(101106318), Domestic Rabbit ATP5B(100353514), domestic guinea pig Atp5b(100718614), naked mole-rat Atp5b(101701683)

UniProtKB ID: P06576, A8K4X0, Q14283

Gene ID:

Human(506) Summary: This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the beta subunit of the catalytic core. [provided by RefSeq, Jul 2008]

Mouse(11947) ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit

Rat(171374) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

Zebrafish(554135) ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit

cow(327675) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

Horse(100059825) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

domestic cat(101087245) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

dog(403669) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

chicken(426673) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

sheep(101106318) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

Domestic Rabbit(100353514) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

domestic guinea pig(100718614) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

naked mole-rat(101701683) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

Gene Class: ATPase

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

MAB3494	Anti-ATP Synthase Antibody, β chain, clone 4.3E8.D1 clone 4.3E8.D1, Chemicon^®, from mouse	human, rat, mouse	immunocytochemistry, immunoprecipitation (IP)	pricing

MABS1304	Anti-ATP Synthase subunit β Antibody, clone 11/21-7-A8 clone 11/21-7-A8, from mouse	human, rat, mouse	dot blot, ELISA, immunocytochemistry, western blot	pricing

AV48185	Anti-ATP5B (AB1) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder	pig, human, rabbit, canine, rabbit, mouse, rat, horse, bovine	immunohistochemistry, western blot	pricing

AV48186	Anti-ATP5B (AB2) antibody produced in rabbit IgG fraction of antiserum	guinea pig, dog, mouse, bovine, rabbit, human, rat, horse	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

GW22827	Anti-ATP5B antibody produced in chicken affinity isolated antibody, buffered aqueous solution	human, rat, mouse	western blot	pricing

SAB1405500	Anti-ATP5B antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

HPA001520	Anti-ATP5B antibody produced in rabbit Ab1, Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	rat, mouse, human	immunofluorescence, immunohistochemistry, western blot	pricing

HPA001528	Anti-ATP5B antibody produced in rabbit Ab2, Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	mouse, rat, human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB2108051	Anti-ATP5B antibody produced in rabbit IgG fraction of antiserum	bovine, human, rat, pig, mouse, horse, rabbit, dog, yeast	immunohistochemistry, western blot	pricing

A9728	Monoclonal Anti-ATP Synthase β antibody produced in mouse 1 mg/mL, clone 4.3E8.D10, purified immunoglobulin, buffered aqueous solution	rat, human, mouse	immunofluorescence, immunoprecipitation (IP), western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST84512	PrEST Antigen ATP5B Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

APREST84513	PrEST Antigen ATP5B Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST22724	SILu^™PrEST ATPB SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST22725	SILu^™PrEST ATPB SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

AQUA Peptides

Product #	Description	Species	Add to Cart

AQ0837	AQUA^™ Peptide VVDLLAPYA[K]	human, mouse, rat	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_016774	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_016774	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_016774	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_001686	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_001686	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_001686	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU029131	MISSION^® esiRNA targeting human ATP5B	human	pricing

EMU006481	MISSION^® esiRNA targeting mouse Atp5b	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_001686	Rosetta Predictions	human	pricing
NM_134364	Rosetta Predictions	rat	pricing
NM_016774	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001686	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00332344 predicted	997
2	SASI_Hs01_00210139 predicted	402
3	SASI_Hs01_00210142 predicted	645
4	SASI_Hs01_00210145 predicted	234
5	SASI_Hs02_00332345 predicted	233
6	SASI_Hs02_00332346 predicted	889
7	SASI_Hs02_00332347 predicted	649
8	SASI_Hs01_00210140 predicted	1317
9	SASI_Hs02_00332348 predicted	1122
10	SASI_Hs02_00332349 predicted	1604
11	SASI_Hs01_00210141 predicted	638
12	SASI_Hs01_00210143 predicted	838
13	SASI_Hs01_00210144 predicted	534
14	SASI_Hs01_00210146 predicted	516
15	SASI_Hs01_00210147 predicted	427
16	SASI_Hs01_00210148 predicted	841

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_134364	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00087782 predicted	555
2	SASI_Rn02_00267925 predicted	449
3	SASI_Rn01_00087787 predicted	1509
4	SASI_Rn01_00087788 predicted	446
5	SASI_Rn01_00087790 predicted	1038
6	SASI_Rn02_00267926 predicted	671
7	SASI_Rn01_00087783 predicted	915
8	SASI_Rn01_00087784 predicted	656
9	SASI_Rn01_00087785 predicted	547
10	SASI_Rn02_00267927 predicted	1183
11	SASI_Rn01_00087786 predicted	747
12	SASI_Rn01_00087789 predicted	1196
13	SASI_Rn01_00087791 predicted	808

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_016774	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00323540 predicted	372
2	SASI_Mm01_00131224 predicted	875
3	SASI_Mm01_00131225 predicted	905
4	SASI_Mm01_00131226 predicted	708
5	SASI_Mm01_00131227 predicted	744
6	SASI_Mm01_00131228 predicted	626
7	SASI_Mm01_00131229 predicted	1224
8	SASI_Mm01_00131230 predicted	1139
9	SASI_Mm02_00323541 predicted	654
10	SASI_Mm01_00131231 predicted	981
11	SASI_Mm01_00131222 predicted	566
12	SASI_Mm01_00131223 predicted	659

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_016774 VALIDATED	ATP5B MISSION shRNA Bacterial Glycerol Stock ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	Mouse

9 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000076230
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016774.2-337s1c1
	Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000331937
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016774.3-337s21c1
	Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000076228
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016774.2-1633s1c1
	Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000076231
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_016774.2-1095s1c1
	Sequence:CCGGGCTATCTATGTGCCTGCTGATCTCGAGATCAGCAGGCACATAGATAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000076232
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016774.2-1526s1c1
	Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000222644
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_016774.2-674s1c2
	Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000309397
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016774.3-674s21c1
	Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000309399
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016774.3-1526s21c1
	Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000309398
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_016774.3-1633s21c1
	Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_016774 VALIDATED	ATP5B MISSION shRNA shRNA Plasmid DNA ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	Mouse

9 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000076230
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016774.2-337s1c1
	Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000331937
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016774.3-337s21c1
	Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000076228
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016774.2-1633s1c1
	Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000076231
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_016774.2-1095s1c1
	Sequence:CCGGGCTATCTATGTGCCTGCTGATCTCGAGATCAGCAGGCACATAGATAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000076232
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016774.2-1526s1c1
	Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000222644
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_016774.2-674s1c2
	Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000309397
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016774.3-674s21c1
	Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000309399
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016774.3-1526s21c1
	Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000309398
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_016774.3-1633s21c1
	Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_016774 VALIDATED	ATP5B MISSION shRNA Lentiviral Transduction Particles ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	Mouse

9 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000076230
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016774.2-337s1c1
	Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000331937
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016774.3-337s21c1
	Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000076228
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016774.2-1633s1c1
	Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000076231
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_016774.2-1095s1c1
	Sequence:CCGGGCTATCTATGTGCCTGCTGATCTCGAGATCAGCAGGCACATAGATAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000076232
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016774.2-1526s1c1
	Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000222644
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_016774.2-674s1c2
	Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000309397
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016774.3-674s21c1
	Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000309399
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016774.3-1526s21c1
	Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000309398
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_016774.3-1633s21c1
	Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_001686 VALIDATED	ATP5B MISSION shRNA Bacterial Glycerol Stock ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	Human

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000043433
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-808s1c1
	Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000043434
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-1393s1c1
	Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000043435
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001686.2-154s1c1
	Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000043437
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-327s1c1
	Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000043436
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-964s1c1
	Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300458
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-1059s21c1
	Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300457
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-422s21c1
	Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300456
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001686.3-903s21c1
	Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300455
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-249s21c1
	Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300454
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-1488s21c1
	Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_001686 VALIDATED	ATP5B MISSION shRNA shRNA Plasmid DNA ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	Human

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000043433
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-808s1c1
	Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000043434
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-1393s1c1
	Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000043435
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001686.2-154s1c1
	Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000043437
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-327s1c1
	Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000043436
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-964s1c1
	Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000300458
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-1059s21c1
	Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000300457
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-422s21c1
	Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000300456
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001686.3-903s21c1
	Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000300455
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-249s21c1
	Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000300454
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-1488s21c1
	Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_001686 VALIDATED	ATP5B MISSION shRNA Lentiviral Transduction Particles ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	Human

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000043433
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-808s1c1
	Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000043434
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-1393s1c1
	Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000043435
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001686.2-154s1c1
	Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000043437
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-327s1c1
	Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000043436
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001686.2-964s1c1
	Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300458
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-1059s21c1
	Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300457
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-422s21c1
	Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300456
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001686.3-903s21c1
	Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300455
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-249s21c1
	Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300454
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001686.3-1488s21c1
	Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart