EMAIL THIS PAGE TO A FRIEND

ATP5I

ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E

33 Gene Product Result for
Synonyms: ATP5K
UniProtKB ID: P56385, Q0D2L9
Gene ID:
Human(521) Summary: Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the e subunit of the Fo complex. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
Rat(140608) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E
chicken(769146) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E
domestic cat(101094757) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E
cow(338040) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E
domestic guinea pig(100721311) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E
naked mole-rat(101704437) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E
sheep(101111455) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007100 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101501 MISSION® esiRNA esiRNA human ATP5I (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007100 Rosetta Predictions human pricing
NM_080481 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342935 predicted 310
2 SASI_Hs01_00216973 predicted 160
3 SASI_Hs01_00216974 predicted 94
4 SASI_Hs01_00216975 predicted 308
5 SASI_Hs01_00216976 predicted 268
6 SASI_Hs01_00216977 predicted 92
7 SASI_Hs01_00216978 predicted 231
8 SASI_Hs01_00216979 predicted 310
9 SASI_Hs01_00216980 predicted 84
10 SASI_Hs01_00216981 predicted 287
11 SASI_Hs01_00216982 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075042 predicted 90
2 SASI_Rn01_00075044 predicted 90
3 SASI_Rn01_00075045 predicted 85
4 SASI_Rn02_00267236 predicted 194
5 SASI_Rn01_00075046 predicted 157
6 SASI_Rn01_00075048 predicted 91
7 SASI_Rn01_00075050 predicted 167
8 SASI_Rn02_00267237 predicted 49
9 SASI_Rn01_00075051 predicted 61
10 SASI_Rn02_00267238 predicted 91
11 SASI_Rn01_00075043 predicted 159
12 SASI_Rn01_00075047 predicted 23
13 SASI_Rn01_00075049 predicted 91
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007100
VALIDATED
ATP5I MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007100.2-318s21c1
Sequence:CCGGTGGACCAGCAGCGGATGAATACTCGAGTATTCATCCGCTGCTGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007100.2-167s21c1
Sequence:CCGGCACGCGCTACAATTACCTAAACTCGAGTTTAGGTAATTGTAGCGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007100.2-238s21c1
Sequence:CCGGAGGATGAACTGAAACGGATTGCTCGAGCAATCCGTTTCAGTTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007100.2-270s21c1
Sequence:CCGGGCAGAAGATGACAGCATATTACTCGAGTAATATGCTGTCATCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007100.2-204s21c1
Sequence:CCGGGAGAGGAGGATAGCAGCAGAACTCGAGTTCTGCTGCTATCCTCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-142s1c1
Sequence:CCGGGCCACGCGCTACAATTACCTACTCGAGTAGGTAATTGTAGCGCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-111s1c1
Sequence:CCGGCTCCGCCCTGTTCCTCGGTGTCTCGAGACACCGAGGAACAGGGCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-181s1c1
Sequence:CCGGGAGAGGAGGATAGCAGCAGAACTCGAGTTCTGCTGCTATCCTCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-167s1c1
Sequence:CCGGCTCGGGCAGAAGAGGAGAGGACTCGAGTCCTCTCCTCTTCTGCCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-186s1c1
Sequence:CCGGGAGGATAGCAGCAGAAGAGAACTCGAGTTCTCTTCTGCTGCTATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007100
VALIDATED
ATP5I MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007100.2-318s21c1
Sequence:CCGGTGGACCAGCAGCGGATGAATACTCGAGTATTCATCCGCTGCTGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007100.2-167s21c1
Sequence:CCGGCACGCGCTACAATTACCTAAACTCGAGTTTAGGTAATTGTAGCGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007100.2-238s21c1
Sequence:CCGGAGGATGAACTGAAACGGATTGCTCGAGCAATCCGTTTCAGTTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007100.2-270s21c1
Sequence:CCGGGCAGAAGATGACAGCATATTACTCGAGTAATATGCTGTCATCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007100.2-204s21c1
Sequence:CCGGGAGAGGAGGATAGCAGCAGAACTCGAGTTCTGCTGCTATCCTCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-142s1c1
Sequence:CCGGGCCACGCGCTACAATTACCTACTCGAGTAGGTAATTGTAGCGCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-111s1c1
Sequence:CCGGCTCCGCCCTGTTCCTCGGTGTCTCGAGACACCGAGGAACAGGGCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-181s1c1
Sequence:CCGGGAGAGGAGGATAGCAGCAGAACTCGAGTTCTGCTGCTATCCTCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-167s1c1
Sequence:CCGGCTCGGGCAGAAGAGGAGAGGACTCGAGTCCTCTCCTCTTCTGCCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-186s1c1
Sequence:CCGGGAGGATAGCAGCAGAAGAGAACTCGAGTTCTCTTCTGCTGCTATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007100
VALIDATED
ATP5I MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007100.2-318s21c1
Sequence:CCGGTGGACCAGCAGCGGATGAATACTCGAGTATTCATCCGCTGCTGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007100.2-167s21c1
Sequence:CCGGCACGCGCTACAATTACCTAAACTCGAGTTTAGGTAATTGTAGCGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007100.2-238s21c1
Sequence:CCGGAGGATGAACTGAAACGGATTGCTCGAGCAATCCGTTTCAGTTCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007100.2-270s21c1
Sequence:CCGGGCAGAAGATGACAGCATATTACTCGAGTAATATGCTGTCATCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007100.2-204s21c1
Sequence:CCGGGAGAGGAGGATAGCAGCAGAACTCGAGTTCTGCTGCTATCCTCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-142s1c1
Sequence:CCGGGCCACGCGCTACAATTACCTACTCGAGTAGGTAATTGTAGCGCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-111s1c1
Sequence:CCGGCTCCGCCCTGTTCCTCGGTGTCTCGAGACACCGAGGAACAGGGCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-181s1c1
Sequence:CCGGGAGAGGAGGATAGCAGCAGAACTCGAGTTCTGCTGCTATCCTCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-167s1c1
Sequence:CCGGCTCGGGCAGAAGAGGAGAGGACTCGAGTCCTCTCCTCTTCTGCCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007100.1-186s1c1
Sequence:CCGGGAGGATAGCAGCAGAAGAGAACTCGAGTTCTCTTCTGCTGCTATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)