EMAIL THIS PAGE TO A FRIEND

ATP6V0B

ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b

70 Gene Product Result for
Synonyms: ATP6F HATPL VMA16
UniProtKB ID: Q99437, D3DPY5, Q6IB32
Gene ID:
Human(533) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is part of the transmembrane V0 domain and is the human counterpart of yeast VMA16. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(114143) ATPase, H+ transporting, lysosomal V0 subunit B
Rat(298451) ATPase, H+ transporting, lysosomal V0 subunit B
naked mole-rat(101718458) ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
domestic guinea pig(100720289) ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
sheep(101114221) ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
Zebrafish(321724) ATPase, H+ transporting, V0 subunit B
chicken(424575) ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
dog(482528) ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
cow(505684) ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
domestic cat(101084376) ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033617 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033617 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033617 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004047 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039457 Rosetta Predictions human pricing
NM_004047 Rosetta Predictions human pricing
NM_001106681 Rosetta Predictions rat pricing
NM_033617 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308508 predicted 567
2 SASI_Hs01_00233786 predicted 669
3 SASI_Hs02_00308509 predicted 738
4 SASI_Hs01_00233787 predicted 756
5 SASI_Hs01_00233788 predicted 492
6 SASI_Hs01_00233789 predicted 753
7 SASI_Hs01_00233792 predicted 662
8 SASI_Hs01_00233793 predicted 381
9 SASI_Hs01_00233794 predicted 488
10 SASI_Hs01_00233795 predicted 439
11 SASI_Hs01_00233790 predicted 665
12 SASI_Hs01_00233791 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336805 predicted 616
2 SASI_Hs01_00208524 predicted 717
3 SASI_Hs02_00336806 predicted 793
4 SASI_Hs01_00208525 predicted 806
5 SASI_Hs01_00208526 predicted 542
6 SASI_Hs01_00208527 predicted 801
7 SASI_Hs01_00208530 predicted 713
8 SASI_Hs01_00208531 predicted 430
9 SASI_Hs01_00208532 predicted 536
10 SASI_Hs01_00208533 predicted 491
11 SASI_Hs01_00208528 predicted 707
12 SASI_Hs01_00208529 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221338 predicted 368
2 SASI_Rn02_00221339 predicted 306
3 SASI_Rn02_00221340 predicted 439
4 SASI_Rn02_00221341 predicted 324
5 SASI_Rn02_00221342 predicted 353
6 SASI_Rn02_00221343 predicted 360
7 SASI_Rn02_00221344 predicted 409
8 SASI_Rn02_00221345 predicted 240
9 SASI_Rn02_00221346 predicted 444
10 SASI_Rn02_00221347 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047410 predicted 702
2 SASI_Mm01_00047411 predicted 245
3 SASI_Mm01_00047412 predicted 195
4 SASI_Mm01_00047413 predicted 460
5 SASI_Mm01_00047414 predicted 464
6 SASI_Mm01_00047415 predicted 689
7 SASI_Mm02_00337474 predicted 691
8 SASI_Mm01_00047416 predicted 424
9 SASI_Mm01_00047417 predicted 469
10 SASI_Mm02_00337475 predicted 484
11 SASI_Mm01_00047418 predicted 634
12 SASI_Mm01_00047419 predicted 250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033617
VALIDATED
ATP6V0B MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-694s1c1
Sequence:CCGGCAGAGTGAAGATGGGTGACTACTCGAGTAGTCACCCATCTTCACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-736s1c1
Sequence:CCGGCGTGCCCTACTGTTATTTATTCTCGAGAATAAATAACAGTAGGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-490s1c1
Sequence:CCGGCCATGCAGGTTACTCCATGTTCTCGAGAACATGGAGTAACCTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-192s1c1
Sequence:CCGGGCTTTCGCTTTGATGTGGCATCTCGAGATGCCACATCAAAGCGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-160s1c1
Sequence:CCGGTGTGGGAATCTGCTACACCATCTCGAGATGGTGTAGCAGATTCCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-732s21c1
Sequence:CCGGCGTGCCCTACTGTTATTTATTCTCGAGAATAAATAACAGTAGGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033617.3-188s21c1
Sequence:CCGGGCTTTCGCTTTGATGTGGCATCTCGAGATGCCACATCAAAGCGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-486s21c1
Sequence:CCGGCCATGCAGGTTACTCCATGTTCTCGAGAACATGGAGTAACCTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-690s21c1
Sequence:CCGGCAGAGTGAAGATGGGTGACTACTCGAGTAGTCACCCATCTTCACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-156s21c1
Sequence:CCGGTGTGGGAATCTGCTACACCATCTCGAGATGGTGTAGCAGATTCCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033617
VALIDATED
ATP6V0B MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-694s1c1
Sequence:CCGGCAGAGTGAAGATGGGTGACTACTCGAGTAGTCACCCATCTTCACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-736s1c1
Sequence:CCGGCGTGCCCTACTGTTATTTATTCTCGAGAATAAATAACAGTAGGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-490s1c1
Sequence:CCGGCCATGCAGGTTACTCCATGTTCTCGAGAACATGGAGTAACCTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-192s1c1
Sequence:CCGGGCTTTCGCTTTGATGTGGCATCTCGAGATGCCACATCAAAGCGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-160s1c1
Sequence:CCGGTGTGGGAATCTGCTACACCATCTCGAGATGGTGTAGCAGATTCCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-732s21c1
Sequence:CCGGCGTGCCCTACTGTTATTTATTCTCGAGAATAAATAACAGTAGGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033617.3-188s21c1
Sequence:CCGGGCTTTCGCTTTGATGTGGCATCTCGAGATGCCACATCAAAGCGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-486s21c1
Sequence:CCGGCCATGCAGGTTACTCCATGTTCTCGAGAACATGGAGTAACCTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-690s21c1
Sequence:CCGGCAGAGTGAAGATGGGTGACTACTCGAGTAGTCACCCATCTTCACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-156s21c1
Sequence:CCGGTGTGGGAATCTGCTACACCATCTCGAGATGGTGTAGCAGATTCCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033617
VALIDATED
ATP6V0B MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-694s1c1
Sequence:CCGGCAGAGTGAAGATGGGTGACTACTCGAGTAGTCACCCATCTTCACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-736s1c1
Sequence:CCGGCGTGCCCTACTGTTATTTATTCTCGAGAATAAATAACAGTAGGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-490s1c1
Sequence:CCGGCCATGCAGGTTACTCCATGTTCTCGAGAACATGGAGTAACCTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-192s1c1
Sequence:CCGGGCTTTCGCTTTGATGTGGCATCTCGAGATGCCACATCAAAGCGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033617.1-160s1c1
Sequence:CCGGTGTGGGAATCTGCTACACCATCTCGAGATGGTGTAGCAGATTCCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-732s21c1
Sequence:CCGGCGTGCCCTACTGTTATTTATTCTCGAGAATAAATAACAGTAGGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033617.3-188s21c1
Sequence:CCGGGCTTTCGCTTTGATGTGGCATCTCGAGATGCCACATCAAAGCGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-486s21c1
Sequence:CCGGCCATGCAGGTTACTCCATGTTCTCGAGAACATGGAGTAACCTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-690s21c1
Sequence:CCGGCAGAGTGAAGATGGGTGACTACTCGAGTAGTCACCCATCTTCACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033617.3-156s21c1
Sequence:CCGGTGTGGGAATCTGCTACACCATCTCGAGATGGTGTAGCAGATTCCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004047
VALIDATED
ATP6V0B MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004047.2-610s1c1
Sequence:CCGGCCCAGCCTCTTTGTAAAGATTCTCGAGAATCTTTACAAAGAGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004047.2-190s1c1
Sequence:CCGGGATTTGGGCTTCCGCTTTGATCTCGAGATCAAAGCGGAAGCCCAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004047.2-411s1c1
Sequence:CCGGCGGCATCATCATGGCAATTGTCTCGAGACAATTGCCATGATGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004047.2-197s1c1
Sequence:CCGGGCTTCCGCTTTGATGTGGCATCTCGAGATGCCACATCAAAGCGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004047.2-305s1c1
Sequence:CCGGGCATCTATATTACCGGCTCCTCTCGAGAGGAGCCGGTAATATAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-849s21c1
Sequence:CCGGCCTCTTGCTGCGTGTTGATTTCTCGAGAAATCAACACGCAGCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-199s21c1
Sequence:CCGGGATTTGGGCTTCCGCTTTGATCTCGAGATCAAAGCGGAAGCCCAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-619s21c1
Sequence:CCGGCCCAGCCTCTTTGTAAAGATTCTCGAGAATCTTTACAAAGAGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-420s21c1
Sequence:CCGGCGGCATCATCATGGCAATTGTCTCGAGACAATTGCCATGATGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-176s21c1
Sequence:CCGGTGGGAGTCTGCTACACCATTTCTCGAGAAATGGTGTAGCAGACTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004047
VALIDATED
ATP6V0B MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004047.2-610s1c1
Sequence:CCGGCCCAGCCTCTTTGTAAAGATTCTCGAGAATCTTTACAAAGAGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004047.2-190s1c1
Sequence:CCGGGATTTGGGCTTCCGCTTTGATCTCGAGATCAAAGCGGAAGCCCAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004047.2-411s1c1
Sequence:CCGGCGGCATCATCATGGCAATTGTCTCGAGACAATTGCCATGATGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004047.2-197s1c1
Sequence:CCGGGCTTCCGCTTTGATGTGGCATCTCGAGATGCCACATCAAAGCGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004047.2-305s1c1
Sequence:CCGGGCATCTATATTACCGGCTCCTCTCGAGAGGAGCCGGTAATATAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-849s21c1
Sequence:CCGGCCTCTTGCTGCGTGTTGATTTCTCGAGAAATCAACACGCAGCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-199s21c1
Sequence:CCGGGATTTGGGCTTCCGCTTTGATCTCGAGATCAAAGCGGAAGCCCAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-619s21c1
Sequence:CCGGCCCAGCCTCTTTGTAAAGATTCTCGAGAATCTTTACAAAGAGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-420s21c1
Sequence:CCGGCGGCATCATCATGGCAATTGTCTCGAGACAATTGCCATGATGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-176s21c1
Sequence:CCGGTGGGAGTCTGCTACACCATTTCTCGAGAAATGGTGTAGCAGACTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004047
VALIDATED
ATP6V0B MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004047.2-610s1c1
Sequence:CCGGCCCAGCCTCTTTGTAAAGATTCTCGAGAATCTTTACAAAGAGGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004047.2-190s1c1
Sequence:CCGGGATTTGGGCTTCCGCTTTGATCTCGAGATCAAAGCGGAAGCCCAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004047.2-411s1c1
Sequence:CCGGCGGCATCATCATGGCAATTGTCTCGAGACAATTGCCATGATGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004047.2-197s1c1
Sequence:CCGGGCTTCCGCTTTGATGTGGCATCTCGAGATGCCACATCAAAGCGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004047.2-305s1c1
Sequence:CCGGGCATCTATATTACCGGCTCCTCTCGAGAGGAGCCGGTAATATAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-849s21c1
Sequence:CCGGCCTCTTGCTGCGTGTTGATTTCTCGAGAAATCAACACGCAGCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-199s21c1
Sequence:CCGGGATTTGGGCTTCCGCTTTGATCTCGAGATCAAAGCGGAAGCCCAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-619s21c1
Sequence:CCGGCCCAGCCTCTTTGTAAAGATTCTCGAGAATCTTTACAAAGAGGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-420s21c1
Sequence:CCGGCGGCATCATCATGGCAATTGTCTCGAGACAATTGCCATGATGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004047.3-176s21c1
Sequence:CCGGTGGGAGTCTGCTACACCATTTCTCGAGAAATGGTGTAGCAGACTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)