EMAIL THIS PAGE TO A FRIEND

ATP6V1G2

ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2

90 Gene Product Result for
Synonyms: ATP6G ATP6G2 NG38 VMA10
UniProtKB ID: O95670, B5MEF0, Q2L6F8, Q5HYU8, Q5RJ63
Gene ID:
Human(534) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of three V1 domain G subunit proteins. This gene had previous gene symbols of ATP6G and ATP6G2. Alternatively spliced transcript variants encoding different isoforms have been described. Read-through transcription also exists between this gene and the downstream DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B (DDX39B) gene. [provided by RefSeq, Feb 2011]
Mouse(66237) ATPase, H+ transporting, lysosomal V1 subunit G2
Rat(368044) ATPase, H+ transporting, lysosomal V1 subunit G2
domestic cat(101084539) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
dog(474840) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
cow(514368) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
naked mole-rat(101720978) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
domestic guinea pig(100723558) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
sheep(101123332) ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069581 MISSION® esiRNA esiRNA targeting mouse Atp6v1g2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130463 Rosetta Predictions human pricing
NM_138282 Rosetta Predictions human pricing
NM_212490 Rosetta Predictions rat pricing
NM_023179 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192628 predicted 684
2 SASI_Hs01_00192629 predicted 654
3 SASI_Hs01_00192630 predicted 653
4 SASI_Hs01_00192631 predicted 582
5 SASI_Hs01_00192632 predicted 663
6 SASI_Hs01_00192633 predicted 666
7 SASI_Hs01_00192634 predicted 634
8 SASI_Hs01_00192635 predicted 683
9 SASI_Hs01_00192636 predicted 670
10 SASI_Hs01_00192637 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173596 predicted 534
2 SASI_Hs01_00173597 predicted 499
3 SASI_Hs01_00173598 predicted 496
4 SASI_Hs01_00173599 predicted 434
5 SASI_Hs01_00173600 predicted 509
6 SASI_Hs01_00173601 predicted 513
7 SASI_Hs01_00173602 predicted 472
8 SASI_Hs01_00173603 predicted 528
9 SASI_Hs01_00173604 predicted 512
10 SASI_Hs01_00173605 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090210 predicted 771
2 SASI_Rn01_00090211 predicted 1052
3 SASI_Rn02_00270469 predicted 284
4 SASI_Rn01_00090212 predicted 1004
5 SASI_Rn01_00090214 predicted 794
6 SASI_Rn01_00090215 predicted 356
7 SASI_Rn01_00090216 predicted 955
8 SASI_Rn01_00090217 predicted 619
9 SASI_Rn02_00270470 predicted 835
10 SASI_Rn01_00090218 predicted 716
11 SASI_Rn01_00090213 predicted 995
12 SASI_Rn01_00090219 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326903 predicted 580
2 SASI_Mm01_00111038 predicted 201
3 SASI_Mm01_00111039 predicted 759
4 SASI_Mm01_00111040 predicted 282
5 SASI_Mm01_00111041 predicted 921
6 SASI_Mm01_00111042 predicted 976
7 SASI_Mm01_00111044 predicted 998
8 SASI_Mm02_00326904 predicted 703
9 SASI_Mm02_00326905 predicted 1000
10 SASI_Mm01_00111045 predicted 419
11 SASI_Mm01_00111037 predicted 981
12 SASI_Mm01_00111043 predicted 653
13 SASI_Mm01_00111046 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130463
ATP6V1G2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-381s1c1
Sequence:CCGGCCGGCGACTGAAGCAGGCAAACTCGAGTTTGCCTGCTTCAGTCGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-444s1c1
Sequence:CCGGAGAGCACGAATTCCAGAGCAACTCGAGTTGCTCTGGAATTCGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-627s1c1
Sequence:CCGGCAACTACCGGATTTCTGCCTACTCGAGTAGGCAGAAATCCGGTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-513s1c1
Sequence:CCGGGCAGGCTACAAGGCGCCAGGTCTCGAGACCTGGCGCCTTGTAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130463.2-358s21c1
Sequence:CCGGGCAGATGCCAGAAAGAGGAAGCTCGAGCTTCCTCTTTCTGGCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130463.2-1127s21c1
Sequence:CCGGTTGTAGCAGTGATTCAGTAAGCTCGAGCTTACTGAATCACTGCTACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130463
ATP6V1G2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-381s1c1
Sequence:CCGGCCGGCGACTGAAGCAGGCAAACTCGAGTTTGCCTGCTTCAGTCGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-444s1c1
Sequence:CCGGAGAGCACGAATTCCAGAGCAACTCGAGTTGCTCTGGAATTCGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-627s1c1
Sequence:CCGGCAACTACCGGATTTCTGCCTACTCGAGTAGGCAGAAATCCGGTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-513s1c1
Sequence:CCGGGCAGGCTACAAGGCGCCAGGTCTCGAGACCTGGCGCCTTGTAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130463.2-358s21c1
Sequence:CCGGGCAGATGCCAGAAAGAGGAAGCTCGAGCTTCCTCTTTCTGGCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130463.2-1127s21c1
Sequence:CCGGTTGTAGCAGTGATTCAGTAAGCTCGAGCTTACTGAATCACTGCTACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130463
ATP6V1G2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-381s1c1
Sequence:CCGGCCGGCGACTGAAGCAGGCAAACTCGAGTTTGCCTGCTTCAGTCGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-444s1c1
Sequence:CCGGAGAGCACGAATTCCAGAGCAACTCGAGTTGCTCTGGAATTCGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-627s1c1
Sequence:CCGGCAACTACCGGATTTCTGCCTACTCGAGTAGGCAGAAATCCGGTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130463.2-513s1c1
Sequence:CCGGGCAGGCTACAAGGCGCCAGGTCTCGAGACCTGGCGCCTTGTAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130463.2-358s21c1
Sequence:CCGGGCAGATGCCAGAAAGAGGAAGCTCGAGCTTCCTCTTTCTGGCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130463.2-1127s21c1
Sequence:CCGGTTGTAGCAGTGATTCAGTAAGCTCGAGCTTACTGAATCACTGCTACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023179
VALIDATED
ATP6V1G2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023179.2-1085s1c1
Sequence:CCGGGCTGTGAATTATCTGTGAGAACTCGAGTTCTCACAGATAATTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023179.2-518s1c1
Sequence:CCGGCTTCTCGGCATGGTCTGTGAACTCGAGTTCACAGACCATGCCGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023179.2-559s1c1
Sequence:CCGGCAACTATCGGGTTACTGTCTACTCGAGTAGACAGTAACCCGATAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023179.2-445s1c1
Sequence:CCGGGCAGGCCACAAGACGGCAGGTCTCGAGACCTGCCGTCTTGTGGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023179.2-342s1c1
Sequence:CCGGCTCAAATGGAGGTGGAGCAATCTCGAGATTGCTCCACCTCCATTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023179
VALIDATED
ATP6V1G2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023179.2-1085s1c1
Sequence:CCGGGCTGTGAATTATCTGTGAGAACTCGAGTTCTCACAGATAATTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023179.2-518s1c1
Sequence:CCGGCTTCTCGGCATGGTCTGTGAACTCGAGTTCACAGACCATGCCGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023179.2-559s1c1
Sequence:CCGGCAACTATCGGGTTACTGTCTACTCGAGTAGACAGTAACCCGATAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023179.2-445s1c1
Sequence:CCGGGCAGGCCACAAGACGGCAGGTCTCGAGACCTGCCGTCTTGTGGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023179.2-342s1c1
Sequence:CCGGCTCAAATGGAGGTGGAGCAATCTCGAGATTGCTCCACCTCCATTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023179
VALIDATED
ATP6V1G2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023179.2-1085s1c1
Sequence:CCGGGCTGTGAATTATCTGTGAGAACTCGAGTTCTCACAGATAATTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023179.2-518s1c1
Sequence:CCGGCTTCTCGGCATGGTCTGTGAACTCGAGTTCACAGACCATGCCGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023179.2-559s1c1
Sequence:CCGGCAACTATCGGGTTACTGTCTACTCGAGTAGACAGTAACCCGATAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023179.2-445s1c1
Sequence:CCGGGCAGGCCACAAGACGGCAGGTCTCGAGACCTGCCGTCTTGTGGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023179.2-342s1c1
Sequence:CCGGCTCAAATGGAGGTGGAGCAATCTCGAGATTGCTCCACCTCCATTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)