EMAIL THIS PAGE TO A FRIEND

ATP8B5P

ATPase, class I, type 8B, member 5, pseudogene

26 Gene Product Result for
Synonyms: FetA
Species: Human ATP8B5P(158381)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029857 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029857 Rosetta Predictions human pricing
NR_003581 Rosetta Predictions human pricing
NR_003582 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150458 predicted 3511
2 SASI_Hs01_00150459 predicted 3141
3 SASI_Hs01_00150460 predicted 3139
4 SASI_Hs01_00150461 predicted 2868
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379642 predicted 2034
2 SASI_Hs02_00379643 predicted 1783
3 SASI_Hs02_00379644 predicted 1770
4 SASI_Hs02_00379645 predicted 911
5 SASI_Hs02_00379646 predicted 900
6 SASI_Hs02_00379647 predicted 861
7 SASI_Hs02_00379648 predicted 1419
8 SASI_Hs02_00379649 predicted 1626
9 SASI_Hs02_00379650 predicted 1963
10 SASI_Hs02_00379651 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379652 predicted 1731
2 SASI_Hs02_00379653 predicted 1720
3 SASI_Hs02_00379654 predicted 1085
4 SASI_Hs02_00379655 predicted 995
5 SASI_Hs02_00379656 predicted 997
6 SASI_Hs02_00379657 predicted 1455
7 SASI_Hs02_00379658 predicted 142
8 SASI_Hs02_00379659 predicted 1040
9 SASI_Hs02_00379660 predicted 1006
10 SASI_Hs02_00379661 predicted 1077
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029857
ATP8B5P MISSION shRNA Bacterial Glycerol Stock
ATPase, class I, type 8B, member 5, pseudogene
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029857.2-3259s1c1
Sequence:CCGGGCAGTGTATCTTGCATGTCATCTCGAGATGACATGCAAGATACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029857.2-3482s1c1
Sequence:CCGGGCATGCATTAATCTTGCAGTTCTCGAGAACTGCAAGATTAATGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029857.2-2810s1c1
Sequence:CCGGCCTGTATCAAATCAGTCACTTCTCGAGAAGTGACTGATTTGATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-3057s1c1
Sequence:CCGGGTACACTGTTACTCAGATCTACTCGAGTAGATCTGAGTAACAGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029857.2-3028s1c1
Sequence:CCGGGAATGCGGTGTAGAAATGTTTCTCGAGAAACATTTCTACACCGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-2881s1c1
Sequence:CCGGGCAGTACCTGAAACAGAAGATCTCGAGATCTTCTGTTTCAGGTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-2787s1c1
Sequence:CCGGCATCTTCATCTATGCAGCCAACTCGAGTTGGCTGCATAGATGAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029857.2-2766s1c1
Sequence:CCGGCCCAGTCAACATTAGACTCTACTCGAGTAGAGTCTAATGTTGACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-2944s1c1
Sequence:CCGGGAGCAAAGCAAGTCTCTTGAACTCGAGTTCAAGAGACTTGCTTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029857
ATP8B5P MISSION shRNA shRNA Plasmid DNA
ATPase, class I, type 8B, member 5, pseudogene
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029857.2-3259s1c1
Sequence:CCGGGCAGTGTATCTTGCATGTCATCTCGAGATGACATGCAAGATACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029857.2-3482s1c1
Sequence:CCGGGCATGCATTAATCTTGCAGTTCTCGAGAACTGCAAGATTAATGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029857.2-2810s1c1
Sequence:CCGGCCTGTATCAAATCAGTCACTTCTCGAGAAGTGACTGATTTGATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-3057s1c1
Sequence:CCGGGTACACTGTTACTCAGATCTACTCGAGTAGATCTGAGTAACAGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029857.2-3028s1c1
Sequence:CCGGGAATGCGGTGTAGAAATGTTTCTCGAGAAACATTTCTACACCGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-2881s1c1
Sequence:CCGGGCAGTACCTGAAACAGAAGATCTCGAGATCTTCTGTTTCAGGTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-2787s1c1
Sequence:CCGGCATCTTCATCTATGCAGCCAACTCGAGTTGGCTGCATAGATGAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029857.2-2766s1c1
Sequence:CCGGCCCAGTCAACATTAGACTCTACTCGAGTAGAGTCTAATGTTGACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-2944s1c1
Sequence:CCGGGAGCAAAGCAAGTCTCTTGAACTCGAGTTCAAGAGACTTGCTTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029857
ATP8B5P MISSION shRNA Lentiviral Transduction Particles
ATPase, class I, type 8B, member 5, pseudogene
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029857.2-3259s1c1
Sequence:CCGGGCAGTGTATCTTGCATGTCATCTCGAGATGACATGCAAGATACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029857.2-3482s1c1
Sequence:CCGGGCATGCATTAATCTTGCAGTTCTCGAGAACTGCAAGATTAATGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029857.2-2810s1c1
Sequence:CCGGCCTGTATCAAATCAGTCACTTCTCGAGAAGTGACTGATTTGATACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-3057s1c1
Sequence:CCGGGTACACTGTTACTCAGATCTACTCGAGTAGATCTGAGTAACAGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029857.2-3028s1c1
Sequence:CCGGGAATGCGGTGTAGAAATGTTTCTCGAGAAACATTTCTACACCGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-2881s1c1
Sequence:CCGGGCAGTACCTGAAACAGAAGATCTCGAGATCTTCTGTTTCAGGTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-2787s1c1
Sequence:CCGGCATCTTCATCTATGCAGCCAACTCGAGTTGGCTGCATAGATGAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029857.2-2766s1c1
Sequence:CCGGCCCAGTCAACATTAGACTCTACTCGAGTAGAGTCTAATGTTGACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029857.2-2944s1c1
Sequence:CCGGGAGCAAAGCAAGTCTCTTGAACTCGAGTTCAAGAGACTTGCTTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)