EMAIL THIS PAGE TO A FRIEND

ATXN2L

ataxin 2-like

201 Gene Product Result for
Synonyms: A2D A2LG A2LP A2RP
Gene ID:
Human(11273) Summary: This gene encodes an ataxin type 2 related protein of unknown function. This protein is a member of the spinocerebellar ataxia (SCAs) family, which is associated with a complex group of neurodegenerative disorders. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(233871) ataxin 2-like
Rat(361649) ataxin 2-like
Zebrafish(324525) ataxin 2-like
cow(539507) ataxin 2-like
Horse(100066373) ataxin 2-like
domestic cat(101094314) ataxin 2-like
dog(489951) ataxin 2-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007245 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007245 Rosetta Predictions human pricing
NM_017492 Rosetta Predictions human pricing
NM_145714 Rosetta Predictions human pricing
NM_148414 Rosetta Predictions human pricing
NM_148415 Rosetta Predictions human pricing
NM_148416 Rosetta Predictions human pricing
NM_001130097 Rosetta Predictions rat pricing
NM_183020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113945 predicted 596
2 SASI_Hs01_00113947 predicted 732
3 SASI_Hs02_00343261 predicted 1351
4 SASI_Hs02_00343262 predicted 1818
5 SASI_Hs02_00343263 predicted 1426
6 SASI_Hs02_00343264 predicted 1635
7 SASI_Hs01_00113950 predicted 718
8 SASI_Hs01_00113951 predicted 788
9 SASI_Hs02_00343265 predicted 986
10 SASI_Hs02_00343266 predicted 967
11 SASI_Hs01_00113946 predicted 608
12 SASI_Hs01_00113948 predicted 548
13 SASI_Hs01_00113949 predicted 542
14 SASI_Hs01_00113952 predicted 592
15 SASI_Hs01_00113953 predicted 518
16 SASI_Hs01_00113954 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200517 predicted 595
2 SASI_Hs01_00200518 predicted 602
3 SASI_Hs01_00200519 predicted 742
4 SASI_Hs01_00200520 predicted 550
5 SASI_Hs01_00200521 predicted 538
6 SASI_Hs01_00200522 predicted 732
7 SASI_Hs01_00200523 predicted 795
8 SASI_Hs01_00200524 predicted 594
9 SASI_Hs01_00200525 predicted 512
10 SASI_Hs01_00200526 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103417 predicted 594
2 SASI_Hs01_00103419 predicted 735
3 SASI_Hs02_00365311 predicted 1347
4 SASI_Hs02_00365312 predicted 1812
5 SASI_Hs02_00365313 predicted 1425
6 SASI_Hs02_00365314 predicted 1631
7 SASI_Hs01_00103422 predicted 726
8 SASI_Hs01_00103423 predicted 790
9 SASI_Hs02_00365315 predicted 994
10 SASI_Hs02_00365316 predicted 971
11 SASI_Hs01_00103418 predicted 601
12 SASI_Hs01_00103420 predicted 549
13 SASI_Hs01_00103421 predicted 533
14 SASI_Hs01_00103424 predicted 595
15 SASI_Hs01_00103425 predicted 515
16 SASI_Hs01_00103426 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150935 predicted 594
2 SASI_Hs01_00150937 predicted 733
3 SASI_Hs02_00365575 predicted 1342
4 SASI_Hs02_00365576 predicted 1816
5 SASI_Hs02_00365577 predicted 1425
6 SASI_Hs02_00365578 predicted 1630
7 SASI_Hs01_00150940 predicted 722
8 SASI_Hs01_00150941 predicted 794
9 SASI_Hs02_00365579 predicted 988
10 SASI_Hs02_00365580 predicted 974
11 SASI_Hs01_00150936 predicted 611
12 SASI_Hs01_00150938 predicted 556
13 SASI_Hs01_00150939 predicted 538
14 SASI_Hs01_00150942 predicted 599
15 SASI_Hs01_00150943 predicted 519
16 SASI_Hs01_00150944 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031189 predicted 589
2 SASI_Hs01_00031191 predicted 734
3 SASI_Hs02_00365581 predicted 1349
4 SASI_Hs02_00365582 predicted 1817
5 SASI_Hs02_00365583 predicted 1430
6 SASI_Hs02_00365584 predicted 1631
7 SASI_Hs01_00031194 predicted 724
8 SASI_Hs01_00031195 predicted 795
9 SASI_Hs02_00365585 predicted 992
10 SASI_Hs02_00365586 predicted 974
11 SASI_Hs01_00031190 predicted 604
12 SASI_Hs01_00031192 predicted 554
13 SASI_Hs01_00031193 predicted 536
14 SASI_Hs01_00031196 predicted 594
15 SASI_Hs01_00031197 predicted 513
16 SASI_Hs01_00031198 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050414 predicted 592
2 SASI_Hs01_00050416 predicted 730
3 SASI_Hs02_00365587 predicted 1342
4 SASI_Hs02_00365588 predicted 1818
5 SASI_Hs02_00365589 predicted 1430
6 SASI_Hs02_00365590 predicted 1632
7 SASI_Hs01_00050419 predicted 720
8 SASI_Hs01_00050420 predicted 789
9 SASI_Hs02_00365591 predicted 989
10 SASI_Hs02_00365592 predicted 965
11 SASI_Hs01_00050415 predicted 608
12 SASI_Hs01_00050417 predicted 551
13 SASI_Hs01_00050418 predicted 533
14 SASI_Hs01_00050421 predicted 591
15 SASI_Hs01_00050422 predicted 520
16 SASI_Hs01_00050423 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255319 predicted 2182
2 SASI_Rn02_00255320 predicted 3025
3 SASI_Rn02_00255321 predicted 2115
4 SASI_Rn02_00255322 predicted 2093
5 SASI_Rn02_00255323 predicted 3061
6 SASI_Rn02_00255324 predicted 2198
7 SASI_Rn02_00255325 predicted 3044
8 SASI_Rn02_00255326 predicted 2361
9 SASI_Rn02_00255327 predicted 2404
10 SASI_Rn02_00255328 predicted 2451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075933 predicted 1854
2 SASI_Mm01_00075934 predicted 1873
3 SASI_Mm01_00075935 predicted 815
4 SASI_Mm01_00075936 predicted 430
5 SASI_Mm01_00075937 predicted 689
6 SASI_Mm01_00075938 predicted 493
7 SASI_Mm01_00075939 predicted 2057
8 SASI_Mm01_00075940 predicted 1911
9 SASI_Mm01_00075941 predicted 1901
10 SASI_Mm01_00075942 predicted 910
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183020
VALIDATED
ATXN2L MISSION shRNA Bacterial Glycerol Stock
ataxin 2-like
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-549s21c1
Sequence:CCGGTTCAAGACTCTGAGCTCAAAGCTCGAGCTTTGAGCTCAGAGTCTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-3500s1c1
Sequence:CCGGCCTCCCATCCTCTCATCTATTCTCGAGAATAGATGAGAGGATGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-438s1c1
Sequence:CCGGCCCGTGTTTGAAGGTGTCTATCTCGAGATAGACACCTTCAAACACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183020.1-1033s1c1
Sequence:CCGGGCCTACGGATTGCTATGGAAACTCGAGTTTCCATAGCAATCCGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-2179s1c1
Sequence:CCGGCCCGTACTCATTCAACACCTTCTCGAGAAGGTGTTGAATGAGTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-2685s1c1
Sequence:CCGGGCCACTGTTCACCAATCCTATCTCGAGATAGGATTGGTGAACAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000452965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-915s21c1
Sequence:CCGGGACAGCAGTCTATCTTCTTACCTCGAGGTAAGAAGATAGACTGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183020.1-3562s21c1
Sequence:CCGGTATTTATAACCTCAGACTTGGCTCGAGCCAAGTCTGAGGTTATAAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-709s21c1
Sequence:CCGGATGCTACTAAAGATAAGTTCACTCGAGTGAACTTATCTTTAGTAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-677s21c1
Sequence:CCGGGCTTGTCCACTTCCGAAATGTCTCGAGACATTTCGGAAGTGGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-497s21c1
Sequence:CCGGGGGTTCTACTTGTGACGTAAACTCGAGTTTACGTCACAAGTAGAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-2576s21c1
Sequence:CCGGTCAAAGTAATCCACGAATGTTCTCGAGAACATTCGTGGATTACTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183020
VALIDATED
ATXN2L MISSION shRNA shRNA Plasmid DNA
ataxin 2-like
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-549s21c1
Sequence:CCGGTTCAAGACTCTGAGCTCAAAGCTCGAGCTTTGAGCTCAGAGTCTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-3500s1c1
Sequence:CCGGCCTCCCATCCTCTCATCTATTCTCGAGAATAGATGAGAGGATGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-438s1c1
Sequence:CCGGCCCGTGTTTGAAGGTGTCTATCTCGAGATAGACACCTTCAAACACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183020.1-1033s1c1
Sequence:CCGGGCCTACGGATTGCTATGGAAACTCGAGTTTCCATAGCAATCCGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-2179s1c1
Sequence:CCGGCCCGTACTCATTCAACACCTTCTCGAGAAGGTGTTGAATGAGTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-2685s1c1
Sequence:CCGGGCCACTGTTCACCAATCCTATCTCGAGATAGGATTGGTGAACAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000452965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-915s21c1
Sequence:CCGGGACAGCAGTCTATCTTCTTACCTCGAGGTAAGAAGATAGACTGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183020.1-3562s21c1
Sequence:CCGGTATTTATAACCTCAGACTTGGCTCGAGCCAAGTCTGAGGTTATAAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-709s21c1
Sequence:CCGGATGCTACTAAAGATAAGTTCACTCGAGTGAACTTATCTTTAGTAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-677s21c1
Sequence:CCGGGCTTGTCCACTTCCGAAATGTCTCGAGACATTTCGGAAGTGGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-497s21c1
Sequence:CCGGGGGTTCTACTTGTGACGTAAACTCGAGTTTACGTCACAAGTAGAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-2576s21c1
Sequence:CCGGTCAAAGTAATCCACGAATGTTCTCGAGAACATTCGTGGATTACTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183020
VALIDATED
ATXN2L MISSION shRNA Lentiviral Transduction Particles
ataxin 2-like
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-549s21c1
Sequence:CCGGTTCAAGACTCTGAGCTCAAAGCTCGAGCTTTGAGCTCAGAGTCTTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-3500s1c1
Sequence:CCGGCCTCCCATCCTCTCATCTATTCTCGAGAATAGATGAGAGGATGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-438s1c1
Sequence:CCGGCCCGTGTTTGAAGGTGTCTATCTCGAGATAGACACCTTCAAACACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183020.1-1033s1c1
Sequence:CCGGGCCTACGGATTGCTATGGAAACTCGAGTTTCCATAGCAATCCGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-2179s1c1
Sequence:CCGGCCCGTACTCATTCAACACCTTCTCGAGAAGGTGTTGAATGAGTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183020.1-2685s1c1
Sequence:CCGGGCCACTGTTCACCAATCCTATCTCGAGATAGGATTGGTGAACAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000452965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-915s21c1
Sequence:CCGGGACAGCAGTCTATCTTCTTACCTCGAGGTAAGAAGATAGACTGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183020.1-3562s21c1
Sequence:CCGGTATTTATAACCTCAGACTTGGCTCGAGCCAAGTCTGAGGTTATAAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-709s21c1
Sequence:CCGGATGCTACTAAAGATAAGTTCACTCGAGTGAACTTATCTTTAGTAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-677s21c1
Sequence:CCGGGCTTGTCCACTTCCGAAATGTCTCGAGACATTTCGGAAGTGGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-497s21c1
Sequence:CCGGGGGTTCTACTTGTGACGTAAACTCGAGTTTACGTCACAAGTAGAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183020.1-2576s21c1
Sequence:CCGGTCAAAGTAATCCACGAATGTTCTCGAGAACATTCGTGGATTACTTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007245
ATXN2L MISSION shRNA Bacterial Glycerol Stock
ataxin 2-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-1974s1c1
Sequence:CCGGCGTATCGGATAAGGAGGACAACTCGAGTTGTCCTCCTTATCCGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-2178s1c1
Sequence:CCGGGCCTCTGCTGTCTGTGAATAACTCGAGTTATTCACAGACAGCAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007245.2-4221s1c1
Sequence:CCGGCCCTGTTCTTTCTTTCCCATTCTCGAGAATGGGAAAGAAAGAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007245.2-4223s1c1
Sequence:CCGGCTGTTCTTTCTTTCCCATTAACTCGAGTTAATGGGAAAGAAAGAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-742s1c1
Sequence:CCGGCTTGTTCACTTCCGAAATGTTCTCGAGAACATTTCGGAAGTGAACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007245.2-4222s1c1
Sequence:CCGGCCTGTTCTTTCTTTCCCATTACTCGAGTAATGGGAAAGAAAGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-2341s1c1
Sequence:CCGGGCACCTCAGATGTATCCATATCTCGAGATATGGATACATCTGAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-808s1c1
Sequence:CCGGGCCATGAACTCGAAAGTGAATCTCGAGATTCACTTTCGAGTTCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-2148s1c1
Sequence:CCGGCCCTAATGCTAAGGAGTTCAACTCGAGTTGAACTCCTTAGCATTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-3294s1c1
Sequence:CCGGCGATGACAGGATTCGTGAGTTCTCGAGAACTCACGAATCCTGTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007245
ATXN2L MISSION shRNA shRNA Plasmid DNA
ataxin 2-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-1974s1c1
Sequence:CCGGCGTATCGGATAAGGAGGACAACTCGAGTTGTCCTCCTTATCCGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-2178s1c1
Sequence:CCGGGCCTCTGCTGTCTGTGAATAACTCGAGTTATTCACAGACAGCAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007245.2-4221s1c1
Sequence:CCGGCCCTGTTCTTTCTTTCCCATTCTCGAGAATGGGAAAGAAAGAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007245.2-4223s1c1
Sequence:CCGGCTGTTCTTTCTTTCCCATTAACTCGAGTTAATGGGAAAGAAAGAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-742s1c1
Sequence:CCGGCTTGTTCACTTCCGAAATGTTCTCGAGAACATTTCGGAAGTGAACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007245.2-4222s1c1
Sequence:CCGGCCTGTTCTTTCTTTCCCATTACTCGAGTAATGGGAAAGAAAGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-2341s1c1
Sequence:CCGGGCACCTCAGATGTATCCATATCTCGAGATATGGATACATCTGAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-808s1c1
Sequence:CCGGGCCATGAACTCGAAAGTGAATCTCGAGATTCACTTTCGAGTTCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-2148s1c1
Sequence:CCGGCCCTAATGCTAAGGAGTTCAACTCGAGTTGAACTCCTTAGCATTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-3294s1c1
Sequence:CCGGCGATGACAGGATTCGTGAGTTCTCGAGAACTCACGAATCCTGTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007245
ATXN2L MISSION shRNA Lentiviral Transduction Particles
ataxin 2-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-1974s1c1
Sequence:CCGGCGTATCGGATAAGGAGGACAACTCGAGTTGTCCTCCTTATCCGATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-2178s1c1
Sequence:CCGGGCCTCTGCTGTCTGTGAATAACTCGAGTTATTCACAGACAGCAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007245.2-4221s1c1
Sequence:CCGGCCCTGTTCTTTCTTTCCCATTCTCGAGAATGGGAAAGAAAGAACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007245.2-4223s1c1
Sequence:CCGGCTGTTCTTTCTTTCCCATTAACTCGAGTTAATGGGAAAGAAAGAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-742s1c1
Sequence:CCGGCTTGTTCACTTCCGAAATGTTCTCGAGAACATTTCGGAAGTGAACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007245.2-4222s1c1
Sequence:CCGGCCTGTTCTTTCTTTCCCATTACTCGAGTAATGGGAAAGAAAGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-2341s1c1
Sequence:CCGGGCACCTCAGATGTATCCATATCTCGAGATATGGATACATCTGAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-808s1c1
Sequence:CCGGGCCATGAACTCGAAAGTGAATCTCGAGATTCACTTTCGAGTTCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-2148s1c1
Sequence:CCGGCCCTAATGCTAAGGAGTTCAACTCGAGTTGAACTCCTTAGCATTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007245.2-3294s1c1
Sequence:CCGGCGATGACAGGATTCGTGAGTTCTCGAGAACTCACGAATCCTGTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)