EMAIL THIS PAGE TO A FRIEND

ATXN3L

ataxin 3-like

28 Gene Product Result for
Synonyms: MJDL
Species: Human ATXN3L(92552)
UniProtKB ID: Q9H3M9, B2RNY8
Gene ID:
Human(92552) Summary: This intronless gene may be a pseudogene (PMID:11450850). This gene is similar to the multi-exon gene which encodes ataxin 3 and contains a coding region which could encode a protein similar to ataxin 3. Mutations in the gene encoding ataxin 3 are associated with Machado-Joseph disease. [provided by RefSeq, Sep 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001135995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001135995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001135995 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117471 MISSION® esiRNA esiRNA human ATXN3L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003585 Rosetta Predictions human pricing
XM_045705 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379672 predicted 195
2 SASI_Hs02_00379673 predicted 456
3 SASI_Hs02_00379674 predicted 1396
4 SASI_Hs02_00379675 predicted 678
5 SASI_Hs02_00379676 predicted 781
6 SASI_Hs02_00379677 predicted 418
7 SASI_Hs02_00379678 predicted 1428
8 SASI_Hs02_00379679 predicted 388
9 SASI_Hs02_00379680 predicted 1409
10 SASI_Hs02_00379681 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_045705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259290 predicted 327
2 SASI_Hs01_00259291 predicted 317
3 SASI_Hs01_00259292 predicted 274
4 SASI_Hs01_00259293 predicted 314
5 SASI_Hs01_00259294 predicted 321
6 SASI_Hs01_00259295 predicted 292
7 SASI_Hs01_00259296 predicted 321
8 SASI_Hs01_00259297 predicted 322
9 SASI_Hs01_00259298 predicted 297
10 SASI_Hs01_00259299 predicted 317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135995
ATXN3L MISSION shRNA Bacterial Glycerol Stock
ataxin 3-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-513s21c1
Sequence:CCGGGCACTGTCTGAACAATCTATTCTCGAGAATAGATTGTTCAGACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-1198s21c1
Sequence:CCGGGAACATCTCCGCAGTACTATTCTCGAGAATAGTACTGCGGAGATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-927s21c1
Sequence:CCGGATTACAACAACAAGCATATTCCTCGAGGAATATGCTTGTTGTTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-769s21c1
Sequence:CCGGCTCGGCATTGATCCTATAAATCTCGAGATTTATAGGATCAATGCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135995.1-1585s21c1
Sequence:CCGGATTATACTGTAGGATCCATTTCTCGAGAAATGGATCCTACAGTATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135995
ATXN3L MISSION shRNA shRNA Plasmid DNA
ataxin 3-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-513s21c1
Sequence:CCGGGCACTGTCTGAACAATCTATTCTCGAGAATAGATTGTTCAGACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-1198s21c1
Sequence:CCGGGAACATCTCCGCAGTACTATTCTCGAGAATAGTACTGCGGAGATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-927s21c1
Sequence:CCGGATTACAACAACAAGCATATTCCTCGAGGAATATGCTTGTTGTTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-769s21c1
Sequence:CCGGCTCGGCATTGATCCTATAAATCTCGAGATTTATAGGATCAATGCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135995.1-1585s21c1
Sequence:CCGGATTATACTGTAGGATCCATTTCTCGAGAAATGGATCCTACAGTATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135995
ATXN3L MISSION shRNA Lentiviral Transduction Particles
ataxin 3-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-513s21c1
Sequence:CCGGGCACTGTCTGAACAATCTATTCTCGAGAATAGATTGTTCAGACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-1198s21c1
Sequence:CCGGGAACATCTCCGCAGTACTATTCTCGAGAATAGTACTGCGGAGATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-927s21c1
Sequence:CCGGATTACAACAACAAGCATATTCCTCGAGGAATATGCTTGTTGTTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135995.1-769s21c1
Sequence:CCGGCTCGGCATTGATCCTATAAATCTCGAGATTTATAGGATCAATGCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135995.1-1585s21c1
Sequence:CCGGATTATACTGTAGGATCCATTTCTCGAGAAATGGATCCTACAGTATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)