EMAIL THIS PAGE TO A FRIEND

BCDIN3D

BCDIN3 domain containing

47 Gene Product Result for
UniProtKB ID: Q7Z5W3, A8K829
Gene ID:
Mouse(75284) BCDIN3 domain containing
Rat(363001) BCDIN3 domain containing
sheep(101122013) BCDIN3 domain containing
domestic guinea pig(100722748) BCDIN3 domain containing
naked mole-rat(101708157) BCDIN3 domain containing
chicken(431303) BCDIN3 domain containing
dog(100685234) BCDIN3 domain containing
cow(505650) BCDIN3 domain containing
domestic cat(101084975) BCDIN3 domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181708 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181708 Rosetta Predictions human pricing
NM_001108751 Rosetta Predictions rat pricing
NM_029236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149968 predicted 456
2 SASI_Hs01_00149969 predicted 1102
3 SASI_Hs01_00149970 predicted 1079
4 SASI_Hs01_00149971 predicted 471
5 SASI_Hs01_00149972 predicted 821
6 SASI_Hs01_00149973 predicted 696
7 SASI_Hs01_00149974 predicted 1065
8 SASI_Hs01_00149975 predicted 1102
9 SASI_Hs01_00149976 predicted 236
10 SASI_Hs01_00149977 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241725 predicted 671
2 SASI_Rn02_00241726 predicted 511
3 SASI_Rn02_00241727 predicted 278
4 SASI_Rn02_00241728 predicted 470
5 SASI_Rn02_00241729 predicted 849
6 SASI_Rn02_00241730 predicted 909
7 SASI_Rn02_00241731 predicted 383
8 SASI_Rn02_00241732 predicted 879
9 SASI_Rn02_00241733 predicted 485
10 SASI_Rn02_00241734 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132632 predicted 349
2 SASI_Mm01_00132631 predicted 468
3 SASI_Mm01_00132635 predicted 726
4 SASI_Mm01_00132639 predicted 626
5 SASI_Mm01_00132637 predicted 624
6 SASI_Mm01_00132636 predicted 622
7 SASI_Mm01_00132638 predicted 886
8 SASI_Mm02_00335014 predicted 435
9 SASI_Mm02_00335015 predicted 940
10 SASI_Mm02_00335016 predicted 1043
11 SASI_Mm01_00132630 predicted 496
12 SASI_Mm01_00132633 predicted 609
13 SASI_Mm01_00132634 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181708
BCDIN3D MISSION shRNA Bacterial Glycerol Stock
BCDIN3 domain containing
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181708.2-976s21c1
Sequence:CCGGTATGTTCATTCTCCTTAATTCCTCGAGGAATTAAGGAGAATGAACATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181708.2-764s21c1
Sequence:CCGGATCATGGCATGGAATTAATATCTCGAGATATTAATTCCATGCCATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181708.2-278s21c1
Sequence:CCGGATCTGAGTGTGGCTCTATACACTCGAGTGTATAGAGCCACACTCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-810s1c1
Sequence:CCGGGAGACTCATCCAATCCCTGAACTCGAGTTCAGGGATTGGATGAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-860s1c1
Sequence:CCGGCAGATTAAGTTTCCAGAAGCACTCGAGTGCTTCTGGAAACTTAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-512s1c1
Sequence:CCGGGATTCATCTGAATCATGGAGACTCGAGTCTCCATGATTCAGATGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-413s1c1
Sequence:CCGGCATGAATCAAAGGACCCGGAACTCGAGTTCCGGGTCCTTTGATTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181708.1-890s1c1
Sequence:CCGGGAGGGCAAGAAGACCAAGAAACTCGAGTTTCTTGGTCTTCTTGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181708
BCDIN3D MISSION shRNA shRNA Plasmid DNA
BCDIN3 domain containing
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181708.2-976s21c1
Sequence:CCGGTATGTTCATTCTCCTTAATTCCTCGAGGAATTAAGGAGAATGAACATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181708.2-764s21c1
Sequence:CCGGATCATGGCATGGAATTAATATCTCGAGATATTAATTCCATGCCATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181708.2-278s21c1
Sequence:CCGGATCTGAGTGTGGCTCTATACACTCGAGTGTATAGAGCCACACTCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-810s1c1
Sequence:CCGGGAGACTCATCCAATCCCTGAACTCGAGTTCAGGGATTGGATGAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-860s1c1
Sequence:CCGGCAGATTAAGTTTCCAGAAGCACTCGAGTGCTTCTGGAAACTTAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-512s1c1
Sequence:CCGGGATTCATCTGAATCATGGAGACTCGAGTCTCCATGATTCAGATGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-413s1c1
Sequence:CCGGCATGAATCAAAGGACCCGGAACTCGAGTTCCGGGTCCTTTGATTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181708.1-890s1c1
Sequence:CCGGGAGGGCAAGAAGACCAAGAAACTCGAGTTTCTTGGTCTTCTTGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181708
BCDIN3D MISSION shRNA Lentiviral Transduction Particles
BCDIN3 domain containing
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181708.2-976s21c1
Sequence:CCGGTATGTTCATTCTCCTTAATTCCTCGAGGAATTAAGGAGAATGAACATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181708.2-764s21c1
Sequence:CCGGATCATGGCATGGAATTAATATCTCGAGATATTAATTCCATGCCATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181708.2-278s21c1
Sequence:CCGGATCTGAGTGTGGCTCTATACACTCGAGTGTATAGAGCCACACTCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-810s1c1
Sequence:CCGGGAGACTCATCCAATCCCTGAACTCGAGTTCAGGGATTGGATGAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-860s1c1
Sequence:CCGGCAGATTAAGTTTCCAGAAGCACTCGAGTGCTTCTGGAAACTTAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-512s1c1
Sequence:CCGGGATTCATCTGAATCATGGAGACTCGAGTCTCCATGATTCAGATGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181708.1-413s1c1
Sequence:CCGGCATGAATCAAAGGACCCGGAACTCGAGTTCCGGGTCCTTTGATTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181708.1-890s1c1
Sequence:CCGGGAGGGCAAGAAGACCAAGAAACTCGAGTTTCTTGGTCTTCTTGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029236
VALIDATED
BCDIN3D MISSION shRNA Bacterial Glycerol Stock
BCDIN3 domain containing
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-630s21c1
Sequence:CCGGCCACAACCCTGGAAGTGTTACCTCGAGGTAACACTTCCAGGGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-416s21c1
Sequence:CCGGCCCTGAGGCTTTGACCTTTATCTCGAGATAAAGGTCAAAGCCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029236.2-881s21c1
Sequence:CCGGGACACGGACAGATTAAGATTCCTCGAGGAATCTTAATCTGTCCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-355s21c1
Sequence:CCGGGCATCCTCTGCTGTGATATAGCTCGAGCTATATCACAGCAGAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-947s21c1
Sequence:CCGGTAACACGGAGAATCGAGTTTGCTCGAGCAAACTCGATTCTCCGTGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029236.1-531s1c1
Sequence:CCGGGCATGTCAGTAACCATGTGGACTCGAGTCCACATGGTTACTGACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029236.1-916s1c1
Sequence:CCGGGACACACACCAGTAAAGAGATCTCGAGATCTCTTTACTGGTGTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029236.1-481s1c1
Sequence:CCGGGAGTTCTTTCTTGAGCCAGTACTCGAGTACTGGCTCAAGAAAGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029236.1-291s1c1
Sequence:CCGGCTCTGTACAAACATTTCCTTTCTCGAGAAAGGAAATGTTTGTACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029236.1-128s1c1
Sequence:CCGGCCGTTCGGAAATTTCCCTCATCTCGAGATGAGGGAAATTTCCGAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029236
VALIDATED
BCDIN3D MISSION shRNA shRNA Plasmid DNA
BCDIN3 domain containing
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-630s21c1
Sequence:CCGGCCACAACCCTGGAAGTGTTACCTCGAGGTAACACTTCCAGGGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-416s21c1
Sequence:CCGGCCCTGAGGCTTTGACCTTTATCTCGAGATAAAGGTCAAAGCCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029236.2-881s21c1
Sequence:CCGGGACACGGACAGATTAAGATTCCTCGAGGAATCTTAATCTGTCCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-355s21c1
Sequence:CCGGGCATCCTCTGCTGTGATATAGCTCGAGCTATATCACAGCAGAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-947s21c1
Sequence:CCGGTAACACGGAGAATCGAGTTTGCTCGAGCAAACTCGATTCTCCGTGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029236.1-531s1c1
Sequence:CCGGGCATGTCAGTAACCATGTGGACTCGAGTCCACATGGTTACTGACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029236.1-916s1c1
Sequence:CCGGGACACACACCAGTAAAGAGATCTCGAGATCTCTTTACTGGTGTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029236.1-481s1c1
Sequence:CCGGGAGTTCTTTCTTGAGCCAGTACTCGAGTACTGGCTCAAGAAAGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029236.1-291s1c1
Sequence:CCGGCTCTGTACAAACATTTCCTTTCTCGAGAAAGGAAATGTTTGTACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029236.1-128s1c1
Sequence:CCGGCCGTTCGGAAATTTCCCTCATCTCGAGATGAGGGAAATTTCCGAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029236
VALIDATED
BCDIN3D MISSION shRNA Lentiviral Transduction Particles
BCDIN3 domain containing
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-630s21c1
Sequence:CCGGCCACAACCCTGGAAGTGTTACCTCGAGGTAACACTTCCAGGGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-416s21c1
Sequence:CCGGCCCTGAGGCTTTGACCTTTATCTCGAGATAAAGGTCAAAGCCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029236.2-881s21c1
Sequence:CCGGGACACGGACAGATTAAGATTCCTCGAGGAATCTTAATCTGTCCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-355s21c1
Sequence:CCGGGCATCCTCTGCTGTGATATAGCTCGAGCTATATCACAGCAGAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029236.2-947s21c1
Sequence:CCGGTAACACGGAGAATCGAGTTTGCTCGAGCAAACTCGATTCTCCGTGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029236.1-531s1c1
Sequence:CCGGGCATGTCAGTAACCATGTGGACTCGAGTCCACATGGTTACTGACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029236.1-916s1c1
Sequence:CCGGGACACACACCAGTAAAGAGATCTCGAGATCTCTTTACTGGTGTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029236.1-481s1c1
Sequence:CCGGGAGTTCTTTCTTGAGCCAGTACTCGAGTACTGGCTCAAGAAAGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029236.1-291s1c1
Sequence:CCGGCTCTGTACAAACATTTCCTTTCTCGAGAAAGGAAATGTTTGTACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029236.1-128s1c1
Sequence:CCGGCCGTTCGGAAATTTCCCTCATCTCGAGATGAGGGAAATTTCCGAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)