EMAIL THIS PAGE TO A FRIEND

BCL11A

B-cell CLL/lymphoma 11A (zinc finger protein)

331 Gene Product Result for
Synonyms: BCL11A-L BCL11A-S BCL11A-XL BCL11a-M CTIP1 EVI9 HBFQTL5 ZNF856
Gene ID:
Human(53335) Summary: This gene encodes a C2H2 type zinc-finger protein by its similarity to the mouse Bcl11a/Evi9 protein. The corresponding mouse gene is a common site of retroviral integration in myeloid leukemia, and may function as a leukemia disease gene, in part, through its interaction with BCL6. During hematopoietic cell differentiation, this gene is down-regulated. It is possibly involved in lymphoma pathogenesis since translocations associated with B-cell malignancies also deregulates its expression. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14025) B cell CLL/lymphoma 11A (zinc finger protein)
Rat(305589) B-cell CLL/lymphoma 11A (zinc finger protein)
domestic guinea pig(100734801) B-cell CLL/lymphoma 11A (zinc finger protein)
sheep(101119124) B-cell CLL/lymphoma 11A (zinc finger protein)
Domestic Rabbit(100355522) B-cell CLL/lymphoma 11A (zinc finger protein)
chicken(421199) B-cell CLL/lymphoma 11A (zinc finger protein)
cow(538680) B-cell CLL/lymphoma 11A (zinc finger protein)
domestic cat(101098704) B-cell CLL/lymphoma 11A (zinc finger protein)
dog(481381) B-cell CLL/lymphoma 11A (zinc finger protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018014 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018014 Rosetta Predictions human pricing
NM_022893 Rosetta Predictions human pricing
NM_138553 Rosetta Predictions human pricing
NM_138559 Rosetta Predictions human pricing
XM_001057685 Rosetta Predictions rat pricing
XM_001057750 Rosetta Predictions rat pricing
XM_001057813 Rosetta Predictions rat pricing
XM_223693 Rosetta Predictions rat pricing
NM_016707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231550 predicted 608
2 SASI_Hs01_00231552 predicted 542
3 SASI_Hs01_00231554 predicted 552
4 SASI_Hs01_00231555 predicted 556
5 SASI_Hs01_00231556 predicted 594
6 SASI_Hs01_00231557 predicted 550
7 SASI_Hs01_00231558 predicted 544
8 SASI_Hs01_00231559 predicted 544
9 SASI_Hs02_00351114 predicted 503
10 SASI_Hs02_00351115 predicted 512
11 SASI_Hs01_00231551 predicted 448
12 SASI_Hs01_00231553 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204608 predicted 609
2 SASI_Hs01_00204610 predicted 544
3 SASI_Hs01_00204612 predicted 553
4 SASI_Hs01_00204613 predicted 560
5 SASI_Hs01_00204614 predicted 586
6 SASI_Hs01_00204615 predicted 555
7 SASI_Hs01_00204616 predicted 552
8 SASI_Hs01_00204617 predicted 540
9 SASI_Hs02_00356176 predicted 500
10 SASI_Hs02_00356177 predicted 511
11 SASI_Hs01_00204609 predicted 439
12 SASI_Hs01_00204611 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069662 predicted 613
2 SASI_Hs01_00069663 predicted 445
3 SASI_Hs01_00069664 predicted 543
4 SASI_Hs01_00069665 predicted 432
5 SASI_Hs01_00069666 predicted 561
6 SASI_Hs01_00069667 predicted 560
7 SASI_Hs01_00069668 predicted 594
8 SASI_Hs01_00069669 predicted 558
9 SASI_Hs01_00069670 predicted 552
10 SASI_Hs01_00069671 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029288 predicted 604
2 SASI_Hs01_00029290 predicted 545
3 SASI_Hs01_00029292 predicted 554
4 SASI_Hs01_00029293 predicted 560
5 SASI_Hs01_00029294 predicted 591
6 SASI_Hs01_00029295 predicted 554
7 SASI_Hs01_00029296 predicted 549
8 SASI_Hs01_00029297 predicted 540
9 SASI_Hs02_00363706 predicted 503
10 SASI_Hs02_00363707 predicted 510
11 SASI_Hs01_00029289 predicted 447
12 SASI_Hs01_00029291 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287189 predicted 1284
2 SASI_Rn02_00287190 predicted 859
3 SASI_Rn02_00287191 predicted 2445
4 SASI_Rn02_00287192 predicted 1367
5 SASI_Rn02_00287193 predicted 873
6 SASI_Rn02_00287194 predicted 1452
7 SASI_Rn02_00287195 predicted 2660
8 SASI_Rn02_00287196 predicted 1067
9 SASI_Rn02_00287197 predicted 1242
10 SASI_Rn02_00287198 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287429 predicted 2918
2 SASI_Rn02_00287430 predicted 2446
3 SASI_Rn02_00287431 predicted 1368
4 SASI_Rn02_00287432 predicted 1451
5 SASI_Rn02_00287433 predicted 1244
6 SASI_Rn02_00287434 predicted 1242
7 SASI_Rn02_00287435 predicted 980
8 SASI_Rn02_00287436 predicted 1167
9 SASI_Rn02_00287437 predicted 2611
10 SASI_Rn02_00287438 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287636 predicted 963
2 SASI_Rn02_00287637 predicted 1290
3 SASI_Rn02_00287638 predicted 858
4 SASI_Rn02_00287639 predicted 2448
5 SASI_Rn02_00287640 predicted 1366
6 SASI_Rn02_00287641 predicted 868
7 SASI_Rn02_00287642 predicted 1454
8 SASI_Rn02_00287643 predicted 2661
9 SASI_Rn02_00287644 predicted 1068
10 SASI_Rn02_00287645 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381580 predicted 2448
2 SASI_Rn02_00381581 predicted 2662
3 SASI_Rn02_00381582 predicted 2462
4 SASI_Rn02_00381583 predicted 2449
5 SASI_Rn02_00381584 predicted 2886
6 SASI_Rn02_00381585 predicted 2448
7 SASI_Rn02_00381586 predicted 2613
8 SASI_Rn02_00381587 predicted 2402
9 SASI_Rn02_00381588 predicted 2609
10 SASI_Rn02_00381589 predicted 2684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032144 predicted 838
2 SASI_Mm01_00032145 predicted 597
3 SASI_Mm01_00032146 predicted 900
4 SASI_Mm01_00032147 predicted 861
5 SASI_Mm01_00032149 predicted 981
6 SASI_Mm01_00032151 predicted 2012
7 SASI_Mm01_00032152 predicted 1059
8 SASI_Mm01_00032153 predicted 846
9 SASI_Mm02_00323387 predicted 2220
10 SASI_Mm02_00323388 predicted 2288
11 SASI_Mm01_00032148 predicted 477
12 SASI_Mm01_00032150 predicted 482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018014
VALIDATED
BCL11A MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 11A (zinc finger protein)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018014.3-2610s21c1
Sequence:CCGGGTCTGTCATCCTGCTAGTTTGCTCGAGCAAACTAGCAGGATGACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018014.3-903s21c1
Sequence:CCGGACCTCTCCATGGGATTCATATCTCGAGATATGAATCCCATGGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018014.3-2847s21c1
Sequence:CCGGGCCAACCTAATTACCTGTATTCTCGAGAATACAGGTAATTAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018014.2-2015s1c1
Sequence:CCGGGCATAGACGATGGCACTGTTACTCGAGTAACAGTGCCATCGTCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018014.2-792s1c1
Sequence:CCGGCGCACAGAACACTCATGGATTCTCGAGAATCCATGAGTGTTCTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018014.2-2497s1c1
Sequence:CCGGGCTCAAGATGTGTGGCAGTTTCTCGAGAAACTGCCACACATCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018014.2-1131s1c1
Sequence:CCGGGCGGTTGAATCCAATGGCTATCTCGAGATAGCCATTGGATTCAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018014.2-547s1c1
Sequence:CCGGCCAGAGGATGACGATTGTTTACTCGAGTAAACAATCGTCATCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018014
VALIDATED
BCL11A MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 11A (zinc finger protein)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018014.3-2610s21c1
Sequence:CCGGGTCTGTCATCCTGCTAGTTTGCTCGAGCAAACTAGCAGGATGACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018014.3-903s21c1
Sequence:CCGGACCTCTCCATGGGATTCATATCTCGAGATATGAATCCCATGGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018014.3-2847s21c1
Sequence:CCGGGCCAACCTAATTACCTGTATTCTCGAGAATACAGGTAATTAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018014.2-2015s1c1
Sequence:CCGGGCATAGACGATGGCACTGTTACTCGAGTAACAGTGCCATCGTCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018014.2-792s1c1
Sequence:CCGGCGCACAGAACACTCATGGATTCTCGAGAATCCATGAGTGTTCTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018014.2-2497s1c1
Sequence:CCGGGCTCAAGATGTGTGGCAGTTTCTCGAGAAACTGCCACACATCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018014.2-1131s1c1
Sequence:CCGGGCGGTTGAATCCAATGGCTATCTCGAGATAGCCATTGGATTCAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018014.2-547s1c1
Sequence:CCGGCCAGAGGATGACGATTGTTTACTCGAGTAAACAATCGTCATCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018014
VALIDATED
BCL11A MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 11A (zinc finger protein)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018014.3-2610s21c1
Sequence:CCGGGTCTGTCATCCTGCTAGTTTGCTCGAGCAAACTAGCAGGATGACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018014.3-903s21c1
Sequence:CCGGACCTCTCCATGGGATTCATATCTCGAGATATGAATCCCATGGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018014.3-2847s21c1
Sequence:CCGGGCCAACCTAATTACCTGTATTCTCGAGAATACAGGTAATTAGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018014.2-2015s1c1
Sequence:CCGGGCATAGACGATGGCACTGTTACTCGAGTAACAGTGCCATCGTCTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018014.2-792s1c1
Sequence:CCGGCGCACAGAACACTCATGGATTCTCGAGAATCCATGAGTGTTCTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018014.2-2497s1c1
Sequence:CCGGGCTCAAGATGTGTGGCAGTTTCTCGAGAAACTGCCACACATCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018014.2-1131s1c1
Sequence:CCGGGCGGTTGAATCCAATGGCTATCTCGAGATAGCCATTGGATTCAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018014.2-547s1c1
Sequence:CCGGCCAGAGGATGACGATTGTTTACTCGAGTAAACAATCGTCATCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016707
BCL11A MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 11A (zinc finger protein)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016707.1-2654s1c1
Sequence:CCGGGCTCCGTTATCCTGCTAGATTCTCGAGAATCTAGCAGGATAACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-303s1c1
Sequence:CCGGGCACTTAAGCAAACGGGAATTCTCGAGAATTCCCGTTTGCTTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-469s1c1
Sequence:CCGGCACAAACGGAAACAATGCAATCTCGAGATTGCATTGTTTCCGTTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-748s1c1
Sequence:CCGGCCGCAGGGTATTTGTAAAGATCTCGAGATCTTTACAAATACCCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-591s1c1
Sequence:CCGGGCCAGAGGATGACGATTGTTTCTCGAGAAACAATCGTCATCCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016707
BCL11A MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 11A (zinc finger protein)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016707.1-2654s1c1
Sequence:CCGGGCTCCGTTATCCTGCTAGATTCTCGAGAATCTAGCAGGATAACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-303s1c1
Sequence:CCGGGCACTTAAGCAAACGGGAATTCTCGAGAATTCCCGTTTGCTTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-469s1c1
Sequence:CCGGCACAAACGGAAACAATGCAATCTCGAGATTGCATTGTTTCCGTTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-748s1c1
Sequence:CCGGCCGCAGGGTATTTGTAAAGATCTCGAGATCTTTACAAATACCCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-591s1c1
Sequence:CCGGGCCAGAGGATGACGATTGTTTCTCGAGAAACAATCGTCATCCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016707
BCL11A MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 11A (zinc finger protein)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016707.1-2654s1c1
Sequence:CCGGGCTCCGTTATCCTGCTAGATTCTCGAGAATCTAGCAGGATAACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-303s1c1
Sequence:CCGGGCACTTAAGCAAACGGGAATTCTCGAGAATTCCCGTTTGCTTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-469s1c1
Sequence:CCGGCACAAACGGAAACAATGCAATCTCGAGATTGCATTGTTTCCGTTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-748s1c1
Sequence:CCGGCCGCAGGGTATTTGTAAAGATCTCGAGATCTTTACAAATACCCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016707.1-591s1c1
Sequence:CCGGGCCAGAGGATGACGATTGTTTCTCGAGAAACAATCGTCATCCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)