EMAIL THIS PAGE TO A FRIEND

BCL2L11

BCL2-like 11 (apoptosis facilitator)

299 Gene Product Result for
Synonyms: BAM BIM BOD
Gene ID:
Human(10018) Summary: The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family and to act as an apoptotic activator. The expression of this gene can be induced by nerve growth factor (NGF), as well as by the forkhead transcription factor FKHR-L1, which suggests a role of this gene in neuronal and lymphocyte apoptosis. Transgenic studies of the mouse counterpart suggested that this gene functions as an essential initiator of apoptosis in thymocyte-negative selection. Several alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Jun 2013]
Mouse(12125) BCL2-like 11 (apoptosis facilitator)
Rat(64547) BCL2-like 11 (apoptosis facilitator)
Zebrafish(100190951) BCL2-like 11
cow(507390) BCL2-like 11 (apoptosis facilitator)
dog(612867) BCL2-like 11 (apoptosis facilitator)
domestic cat(101084615) BCL2-like 11 (apoptosis facilitator)
domestic cat(768267) BCL2-like 11 (apoptosis facilitator)
sheep(100505402) BCL2-like 11 (apoptosis facilitator)
naked mole-rat(101721800) BCL2-like 11 (apoptosis facilitator)
domestic guinea pig(100725284) BCL2-like 11 (apoptosis facilitator)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300531 Anti-BCL2L11 (Ab-69) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
PRS2065 Anti-Bim (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
PRS3405 Anti-Bim (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunocytochemistry, western blot pricing
SAB2500162 Anti-BIM (AD/ACD/ABCD Isoforms) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
B7929 Anti-Bim antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunohistochemistry, microarray, western blot pricing
SAB1306237 ANTI-BIM BH3 DOMAIN antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4500023 Anti-BIM, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300229 Anti-phospho-BCL2L11 (pSer69) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry pricing
WH0010018M1 Monoclonal Anti-BCL2L11 antibody produced in mouse clone 2F10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138621 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074771 MISSION® esiRNA esiRNA targeting mouse Bcl2l11 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006538 Rosetta Predictions human pricing
NM_138621 Rosetta Predictions human pricing
NM_138622 Rosetta Predictions human pricing
NM_138623 Rosetta Predictions human pricing
NM_138624 Rosetta Predictions human pricing
NM_138626 Rosetta Predictions human pricing
NM_138627 Rosetta Predictions human pricing
NM_207002 Rosetta Predictions human pricing
NM_207003 Rosetta Predictions human pricing
NM_022612 Rosetta Predictions rat pricing
NM_171988 Rosetta Predictions rat pricing
NM_171989 Rosetta Predictions rat pricing
NM_009754 Rosetta Predictions mouse pricing
NM_207680 Rosetta Predictions mouse pricing
NM_207681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341791 predicted 642
2 SASI_Hs02_00341792 predicted 425
3 SASI_Hs02_00341793 predicted 523
4 SASI_Hs01_00136836 predicted 559
5 SASI_Hs01_00136834 predicted 989
6 SASI_Hs02_00341794 predicted 667
7 SASI_Hs02_00341795 predicted 892
8 SASI_Hs01_00136838 predicted 564
9 SASI_Hs01_00136839 predicted 527
10 SASI_Hs01_00136840 predicted 534
11 SASI_Hs01_00136835 predicted 307
12 SASI_Hs01_00136837 predicted 444
13 SASI_Hs01_00136841 predicted 704
14 SASI_Hs01_00136842 predicted 315
15 SASI_Hs01_00136843 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061335 predicted 846
2 SASI_Hs02_00363756 predicted 819
3 SASI_Hs01_00061332 predicted 608
4 SASI_Hs02_00363757 predicted 700
5 SASI_Hs01_00061334 predicted 746
6 SASI_Hs01_00061331 predicted 1162
7 SASI_Hs01_00061337 predicted 1075
8 SASI_Hs02_00363758 predicted 742
9 SASI_Hs02_00363759 predicted 700
10 SASI_Hs01_00061338 predicted 715
11 SASI_Hs01_00061333 predicted 479
12 SASI_Hs01_00061336 predicted 626
13 SASI_Hs01_00061339 predicted 893
14 SASI_Hs01_00061340 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216663 predicted 1018
2 SASI_Hs01_00216664 predicted 338
3 SASI_Hs01_00216665 predicted 470
4 SASI_Hs01_00216666 predicted 702
5 SASI_Hs01_00216667 predicted 531
6 SASI_Hs01_00216668 predicted 750
7 SASI_Hs01_00216669 predicted 933
8 SASI_Hs01_00216670 predicted 489
9 SASI_Hs01_00216671 predicted 447
10 SASI_Hs01_00216672 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166224 predicted 837
2 SASI_Hs01_00166225 predicted 153
3 SASI_Hs01_00166226 predicted 289
4 SASI_Hs01_00166227 predicted 526
5 SASI_Hs01_00166228 predicted 343
6 SASI_Hs01_00166229 predicted 570
7 SASI_Hs01_00166230 predicted 751
8 SASI_Hs01_00166231 predicted 300
9 SASI_Hs01_00166232 predicted 261
10 SASI_Hs01_00166233 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020042 predicted 792
2 SASI_Hs01_00020043 predicted 376
3 SASI_Hs01_00020044 predicted 491
4 SASI_Hs01_00020045 predicted 390
5 SASI_Hs01_00020046 predicted 838
6 SASI_Hs01_00020047 predicted 828
7 SASI_Hs01_00020048 predicted 49
8 SASI_Hs01_00020049 predicted 505
9 SASI_Hs01_00020050 predicted 481
10 SASI_Hs01_00020051 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100661 predicted 788
2 SASI_Hs01_00100662 predicted 781
3 SASI_Hs01_00100663 predicted 866
4 SASI_Hs01_00100664 predicted 662
5 SASI_Hs01_00100665 predicted 375
6 SASI_Hs01_00100666 predicted 388
7 SASI_Hs01_00100667 predicted 467
8 SASI_Hs01_00100668 predicted 393
9 SASI_Hs01_00100669 predicted 702
10 SASI_Hs01_00100670 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121346 predicted 524
2 SASI_Hs01_00121347 predicted 387
3 SASI_Hs01_00121348 predicted 123
4 SASI_Hs01_00121349 predicted 205
5 SASI_Hs01_00121350 predicted 438
6 SASI_Hs01_00121351 predicted 415
7 SASI_Hs01_00121352 predicted 393
8 SASI_Hs01_00121353 predicted 545
9 SASI_Hs01_00121354 predicted 49
10 SASI_Hs01_00121355 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122868 predicted 291
2 SASI_Hs01_00122870 predicted 419
3 SASI_Hs01_00122872 predicted 311
4 SASI_Hs01_00122873 predicted 322
5 SASI_Hs02_00373698 predicted 312
6 SASI_Hs01_00122874 predicted 299
7 SASI_Hs01_00122875 predicted 671
8 SASI_Hs01_00122876 predicted 422
9 SASI_Hs02_00373699 predicted 387
10 SASI_Hs01_00122877 predicted 392
11 SASI_Hs01_00122869 predicted 155
12 SASI_Hs01_00122871 predicted 151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158853 predicted 755
2 SASI_Hs01_00158854 predicted 746
3 SASI_Hs01_00158855 predicted 614
4 SASI_Hs01_00158856 predicted 261
5 SASI_Hs01_00158857 predicted 193
6 SASI_Hs01_00158858 predicted 254
7 SASI_Hs01_00158859 predicted 667
8 SASI_Hs01_00158860 predicted 647
9 SASI_Hs01_00158861 predicted 40
10 SASI_Hs01_00158862 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083125 predicted 198
2 SASI_Rn01_00083126 predicted 140
3 SASI_Rn01_00083128 predicted 292
4 SASI_Rn01_00083129 predicted 16
5 SASI_Rn01_00083130 predicted 11
6 SASI_Rn01_00083131 predicted 291
7 SASI_Rn02_00263379 predicted 99
8 SASI_Rn01_00083132 predicted 238
9 SASI_Rn01_00083133 predicted 254
10 SASI_Rn01_00083134 predicted 368
11 SASI_Rn01_00083127 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073266 predicted 353
2 SASI_Rn01_00073267 predicted 306
3 SASI_Rn01_00073268 predicted 300
4 SASI_Rn01_00073269 predicted 352
5 SASI_Rn01_00073270 predicted 249
6 SASI_Rn01_00073271 predicted 299
7 SASI_Rn01_00073272 predicted 303
8 SASI_Rn01_00073273 predicted 293
9 SASI_Rn01_00073274 predicted 303
10 SASI_Rn01_00073275 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088998 predicted 200
2 SASI_Rn01_00088999 predicted 13
3 SASI_Rn01_00089000 predicted 202
4 SASI_Rn01_00089001 predicted 265
5 SASI_Rn01_00089002 predicted 143
6 SASI_Rn01_00089003 predicted 274
7 SASI_Rn01_00089004 predicted 160
8 SASI_Rn01_00089005 predicted 116
9 SASI_Rn01_00089006 predicted 238
10 SASI_Rn02_00269082 predicted 48
11 SASI_Rn01_00088997 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149297 predicted 851
2 SASI_Mm01_00149298 predicted 386
3 SASI_Mm01_00149299 predicted 235
4 SASI_Mm01_00149300 predicted 549
5 SASI_Mm01_00149301 predicted 510
6 SASI_Mm01_00149302 predicted 698
7 SASI_Mm01_00149303 predicted 375
8 SASI_Mm01_00149304 predicted 1000
9 SASI_Mm01_00149305 predicted 585
10 SASI_Mm01_00149306 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030080 predicted 1210
2 SASI_Mm01_00030081 predicted 1107
3 SASI_Mm01_00030082 predicted 534
4 SASI_Mm01_00030083 predicted 891
5 SASI_Mm01_00030084 predicted 768
6 SASI_Mm01_00030085 predicted 1260
7 SASI_Mm01_00030087 predicted 806
8 SASI_Mm01_00030088 predicted 628
9 SASI_Mm01_00030089 predicted 795
10 SASI_Mm02_00352214 predicted 1016
11 SASI_Mm01_00030086 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162797 predicted 407
2 SASI_Mm01_00162799 predicted 230
3 SASI_Mm01_00162800 predicted 362
4 SASI_Mm01_00162801 predicted 640
5 SASI_Mm01_00162802 predicted 595
6 SASI_Mm01_00162803 predicted 788
7 SASI_Mm01_00162804 predicted 467
8 SASI_Mm01_00162805 predicted 328
9 SASI_Mm01_00162806 predicted 1089
10 SASI_Mm02_00352215 predicted 682
11 SASI_Mm01_00162798 predicted 482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009754
VALIDATED
BCL2L11 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 11 (apoptosis facilitator)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009754.1-35s1c1
Sequence:CCGGGTGACAGAGAAGGTGGACAATCTCGAGATTGTCCACCTTCTCTGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009754.1-139s1c1
Sequence:CCGGTCTCAGGAGGAACCTGAAGATCTCGAGATCTTCAGGTTCCTCCTGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009754.1-123s1c1
Sequence:CCGGAGCTTCCATACGACAGTCTCACTCGAGTGAGACTGTCGTATGGAAGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009754.1-165s1c1
Sequence:CCGGCCCGGAGATACGGATTGCACACTCGAGTGTGCAATCCGTATCTCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-433s21c1
Sequence:CCGGGACGAGTTCAACGAAACTTACCTCGAGGTAAGTTTCGTTGAACTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-513s21c1
Sequence:CCGGCTTACAACTGTTACGCTTTATCTCGAGATAAAGCGTAACAGTTGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009754.3-4382s21c1
Sequence:CCGGGTCCACACGTGTCGCTAAATCCTCGAGGATTTAGCGACACGTGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-486s21c1
Sequence:CCGGGGCTGAAGACCACCCTCAAATCTCGAGATTTGAGGGTGGTCTTCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-264s21c1
Sequence:CCGGTGACAGAGAAGGTGGACAATTCTCGAGAATTGTCCACCTTCTCTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009754
VALIDATED
BCL2L11 MISSION shRNA shRNA Plasmid DNA
BCL2-like 11 (apoptosis facilitator)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009754.1-35s1c1
Sequence:CCGGGTGACAGAGAAGGTGGACAATCTCGAGATTGTCCACCTTCTCTGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009754.1-139s1c1
Sequence:CCGGTCTCAGGAGGAACCTGAAGATCTCGAGATCTTCAGGTTCCTCCTGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009754.1-123s1c1
Sequence:CCGGAGCTTCCATACGACAGTCTCACTCGAGTGAGACTGTCGTATGGAAGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009754.1-165s1c1
Sequence:CCGGCCCGGAGATACGGATTGCACACTCGAGTGTGCAATCCGTATCTCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-433s21c1
Sequence:CCGGGACGAGTTCAACGAAACTTACCTCGAGGTAAGTTTCGTTGAACTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-513s21c1
Sequence:CCGGCTTACAACTGTTACGCTTTATCTCGAGATAAAGCGTAACAGTTGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009754.3-4382s21c1
Sequence:CCGGGTCCACACGTGTCGCTAAATCCTCGAGGATTTAGCGACACGTGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-486s21c1
Sequence:CCGGGGCTGAAGACCACCCTCAAATCTCGAGATTTGAGGGTGGTCTTCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-264s21c1
Sequence:CCGGTGACAGAGAAGGTGGACAATTCTCGAGAATTGTCCACCTTCTCTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009754
VALIDATED
BCL2L11 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 11 (apoptosis facilitator)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009754.1-35s1c1
Sequence:CCGGGTGACAGAGAAGGTGGACAATCTCGAGATTGTCCACCTTCTCTGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009754.1-139s1c1
Sequence:CCGGTCTCAGGAGGAACCTGAAGATCTCGAGATCTTCAGGTTCCTCCTGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009754.1-123s1c1
Sequence:CCGGAGCTTCCATACGACAGTCTCACTCGAGTGAGACTGTCGTATGGAAGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009754.1-165s1c1
Sequence:CCGGCCCGGAGATACGGATTGCACACTCGAGTGTGCAATCCGTATCTCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-433s21c1
Sequence:CCGGGACGAGTTCAACGAAACTTACCTCGAGGTAAGTTTCGTTGAACTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-513s21c1
Sequence:CCGGCTTACAACTGTTACGCTTTATCTCGAGATAAAGCGTAACAGTTGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009754.3-4382s21c1
Sequence:CCGGGTCCACACGTGTCGCTAAATCCTCGAGGATTTAGCGACACGTGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-486s21c1
Sequence:CCGGGGCTGAAGACCACCCTCAAATCTCGAGATTTGAGGGTGGTCTTCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009754.3-264s21c1
Sequence:CCGGTGACAGAGAAGGTGGACAATTCTCGAGAATTGTCCACCTTCTCTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138621
VALIDATED
BCL2L11 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 11 (apoptosis facilitator)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_138621.x-541s1c1
Sequence:CCGGATGGTTATCTTACGACTGTTACTCGAGTAACAGTCGTAAGATAACCATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138621.x-537s1c1
Sequence:CCGGACGAATGGTTATCTTACGACTCTCGAGAGTCGTAAGATAACCATTCGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_138621.x-522s1c1
Sequence:CCGGAGCCGAAGACCACCCACGAATCTCGAGATTCGTGGGTGGTCTTCGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138621.x-267s1c1
Sequence:CCGGGTCTCGATCCTCCAGTGGGTACTCGAGTACCCACTGGAGGATCGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-817s21c1
Sequence:CCGGGACCACCCACGAATGGTTATCCTCGAGGATAACCATTCGTGGGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-559s21c1
Sequence:CCGGCGATCCTCCAGTGGGTATTTCCTCGAGGAAATACCCACTGGAGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-839s21c1
Sequence:CCGGTACGACTGTTACGTTACATTGCTCGAGCAATGTAACGTAACAGTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-772s21c1
Sequence:CCGGTACTATGCAAGGAGGGTATTTCTCGAGAAATACCCTCCTTGCATAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-746s21c1
Sequence:CCGGGGCGTATTGGAGACGAGTTTACTCGAGTAAACTCGTCTCCAATACGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138621
VALIDATED
BCL2L11 MISSION shRNA shRNA Plasmid DNA
BCL2-like 11 (apoptosis facilitator)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_138621.x-541s1c1
Sequence:CCGGATGGTTATCTTACGACTGTTACTCGAGTAACAGTCGTAAGATAACCATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138621.x-537s1c1
Sequence:CCGGACGAATGGTTATCTTACGACTCTCGAGAGTCGTAAGATAACCATTCGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_138621.x-522s1c1
Sequence:CCGGAGCCGAAGACCACCCACGAATCTCGAGATTCGTGGGTGGTCTTCGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138621.x-267s1c1
Sequence:CCGGGTCTCGATCCTCCAGTGGGTACTCGAGTACCCACTGGAGGATCGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-817s21c1
Sequence:CCGGGACCACCCACGAATGGTTATCCTCGAGGATAACCATTCGTGGGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-559s21c1
Sequence:CCGGCGATCCTCCAGTGGGTATTTCCTCGAGGAAATACCCACTGGAGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-839s21c1
Sequence:CCGGTACGACTGTTACGTTACATTGCTCGAGCAATGTAACGTAACAGTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-772s21c1
Sequence:CCGGTACTATGCAAGGAGGGTATTTCTCGAGAAATACCCTCCTTGCATAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-746s21c1
Sequence:CCGGGGCGTATTGGAGACGAGTTTACTCGAGTAAACTCGTCTCCAATACGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138621
VALIDATED
BCL2L11 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 11 (apoptosis facilitator)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_138621.x-541s1c1
Sequence:CCGGATGGTTATCTTACGACTGTTACTCGAGTAACAGTCGTAAGATAACCATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138621.x-537s1c1
Sequence:CCGGACGAATGGTTATCTTACGACTCTCGAGAGTCGTAAGATAACCATTCGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_138621.x-522s1c1
Sequence:CCGGAGCCGAAGACCACCCACGAATCTCGAGATTCGTGGGTGGTCTTCGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138621.x-267s1c1
Sequence:CCGGGTCTCGATCCTCCAGTGGGTACTCGAGTACCCACTGGAGGATCGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-817s21c1
Sequence:CCGGGACCACCCACGAATGGTTATCCTCGAGGATAACCATTCGTGGGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-559s21c1
Sequence:CCGGCGATCCTCCAGTGGGTATTTCCTCGAGGAAATACCCACTGGAGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-839s21c1
Sequence:CCGGTACGACTGTTACGTTACATTGCTCGAGCAATGTAACGTAACAGTCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-772s21c1
Sequence:CCGGTACTATGCAAGGAGGGTATTTCTCGAGAAATACCCTCCTTGCATAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138621.3-746s21c1
Sequence:CCGGGGCGTATTGGAGACGAGTTTACTCGAGTAAACTCGTCTCCAATACGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)