EMAIL THIS PAGE TO A FRIEND

BCL6

B-cell CLL/lymphoma 6

170 Gene Product Result for
Synonyms: BCL5 BCL6A LAZ3 ZBTB27 ZNF51
UniProtKB ID: P41182, A7E241, B8PSA7, D3DNV5
Gene ID:
Human(604) Summary: The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal POZ domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the transcription of START-dependent IL-4 responses of B cells. This protein can interact with a variety of POZ-containing proteins that function as transcription corepressors. This gene is found to be frequently translocated and hypermutated in diffuse large-cell lymphoma (DLCL), and may be involved in the pathogenesis of DLCL. Alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Mouse(12053) B cell leukemia/lymphoma 6
Rat(303836) B-cell CLL/lymphoma 6
chicken(424912) B-cell CLL/lymphoma 6
domestic cat(101096665) B-cell CLL/lymphoma 6
Horse(100059642) B-cell CLL/lymphoma 6
cow(539020) B-cell CLL/lymphoma 6
dog(488124) B-cell CLL/lymphoma 6
sheep(101110557) B-cell CLL/lymphoma 6
Domestic Rabbit(100353941) B-cell CLL/lymphoma 6
domestic guinea pig(100731135) B-cell CLL/lymphoma 6
naked mole-rat(101713721) B-cell CLL/lymphoma 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001706 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001706 Rosetta Predictions human pricing
NM_138931 Rosetta Predictions human pricing
NM_001107084 Rosetta Predictions rat pricing
NM_009744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332379 predicted 371
2 SASI_Hs02_00332380 predicted 2134
3 SASI_Hs02_00332381 predicted 2346
4 SASI_Hs01_00056486 predicted 699
5 SASI_Hs02_00332382 predicted 411
6 SASI_Hs02_00332383 predicted 590
7 SASI_Hs01_00056487 predicted 546
8 SASI_Hs01_00056488 predicted 519
9 SASI_Hs02_00332384 predicted 620
10 SASI_Hs02_00332385 predicted 345
11 SASI_Hs01_00056485 predicted 1077
12 SASI_Hs01_00056489 predicted 649
13 SASI_Hs01_00056490 predicted 1852
14 SASI_Hs01_00056491 predicted 686
15 SASI_Hs01_00056492 predicted 736
16 SASI_Hs01_00056493 predicted 1128
17 SASI_Hs01_00056494 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069814 predicted 1170
2 SASI_Hs01_00069815 predicted 802
3 SASI_Hs01_00069816 predicted 653
4 SASI_Hs01_00069817 predicted 620
5 SASI_Hs01_00069818 predicted 744
6 SASI_Hs01_00069819 predicted 1936
7 SASI_Hs01_00069820 predicted 776
8 SASI_Hs01_00069821 predicted 829
9 SASI_Hs01_00069822 predicted 1215
10 SASI_Hs01_00069823 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225336 predicted 698
2 SASI_Rn02_00225337 predicted 445
3 SASI_Rn02_00225338 predicted 1744
4 SASI_Rn02_00225339 predicted 307
5 SASI_Rn02_00225340 predicted 230
6 SASI_Rn02_00225341 predicted 544
7 SASI_Rn02_00225342 predicted 514
8 SASI_Rn02_00225343 predicted 384
9 SASI_Rn02_00225344 predicted 1709
10 SASI_Rn02_00225345 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101566 predicted 383
2 SASI_Mm01_00101567 predicted 595
3 SASI_Mm01_00101568 predicted 244
4 SASI_Mm01_00101569 predicted 1886
5 SASI_Mm01_00101570 predicted 204
6 SASI_Mm01_00101572 predicted 841
7 SASI_Mm01_00101573 predicted 1006
8 SASI_Mm01_00101574 predicted 1648
9 SASI_Mm01_00101575 predicted 1231
10 SASI_Mm02_00316929 predicted 1047
11 SASI_Mm01_00101571 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009744
VALIDATED
BCL6 MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009744.3-373s21c1
Sequence:CCGGCAACCTGAGGGAAGGCAATATCTCGAGATATTGCCTTCCCTCAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009744.3-1415s21c1
Sequence:CCGGCAAGCCAGCCGGCTCAATAATCTCGAGATTATTGAGCCGGCTGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009744.3-137s21c1
Sequence:CCGGGATGTTCTTCTCAACCTTAATCTCGAGATTAAGGTTGAGAAGAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009744.3-798s21c1
Sequence:CCGGGGCAAGTCCCTAATGAGTATACTCGAGTATACTCATTAGGGACTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009744.3-2626s21c1
Sequence:CCGGTGTCAAAGAGAAGGCTTTAATCTCGAGATTAAAGCCTTCTCTTTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009744.2-2073s1c1
Sequence:CCGGGAGAAGTGTAACCTGCACTTTCTCGAGAAAGTGCAGGTTACACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009744.2-209s1c1
Sequence:CCGGTGAGCAGTTTAGAGCCCATAACTCGAGTTATGGGCTCTAAACTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009744.2-251s1c1
Sequence:CCGGCGGCCTGTTCTACAGTATCTTCTCGAGAAGATACTGTAGAACAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009744.2-1424s1c1
Sequence:CCGGCCGGCTCAATAATCTCGTGAACTCGAGTTCACGAGATTATTGAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009744.2-2625s1c1
Sequence:CCGGGCTGTCAAAGAGAAGGCTTTACTCGAGTAAAGCCTTCTCTTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009744
VALIDATED
BCL6 MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009744.3-373s21c1
Sequence:CCGGCAACCTGAGGGAAGGCAATATCTCGAGATATTGCCTTCCCTCAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009744.3-1415s21c1
Sequence:CCGGCAAGCCAGCCGGCTCAATAATCTCGAGATTATTGAGCCGGCTGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009744.3-137s21c1
Sequence:CCGGGATGTTCTTCTCAACCTTAATCTCGAGATTAAGGTTGAGAAGAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009744.3-798s21c1
Sequence:CCGGGGCAAGTCCCTAATGAGTATACTCGAGTATACTCATTAGGGACTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009744.3-2626s21c1
Sequence:CCGGTGTCAAAGAGAAGGCTTTAATCTCGAGATTAAAGCCTTCTCTTTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009744.2-2073s1c1
Sequence:CCGGGAGAAGTGTAACCTGCACTTTCTCGAGAAAGTGCAGGTTACACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009744.2-209s1c1
Sequence:CCGGTGAGCAGTTTAGAGCCCATAACTCGAGTTATGGGCTCTAAACTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009744.2-251s1c1
Sequence:CCGGCGGCCTGTTCTACAGTATCTTCTCGAGAAGATACTGTAGAACAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009744.2-1424s1c1
Sequence:CCGGCCGGCTCAATAATCTCGTGAACTCGAGTTCACGAGATTATTGAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009744.2-2625s1c1
Sequence:CCGGGCTGTCAAAGAGAAGGCTTTACTCGAGTAAAGCCTTCTCTTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009744
VALIDATED
BCL6 MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009744.3-373s21c1
Sequence:CCGGCAACCTGAGGGAAGGCAATATCTCGAGATATTGCCTTCCCTCAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009744.3-1415s21c1
Sequence:CCGGCAAGCCAGCCGGCTCAATAATCTCGAGATTATTGAGCCGGCTGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009744.3-137s21c1
Sequence:CCGGGATGTTCTTCTCAACCTTAATCTCGAGATTAAGGTTGAGAAGAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009744.3-798s21c1
Sequence:CCGGGGCAAGTCCCTAATGAGTATACTCGAGTATACTCATTAGGGACTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009744.3-2626s21c1
Sequence:CCGGTGTCAAAGAGAAGGCTTTAATCTCGAGATTAAAGCCTTCTCTTTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009744.2-2073s1c1
Sequence:CCGGGAGAAGTGTAACCTGCACTTTCTCGAGAAAGTGCAGGTTACACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009744.2-209s1c1
Sequence:CCGGTGAGCAGTTTAGAGCCCATAACTCGAGTTATGGGCTCTAAACTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009744.2-251s1c1
Sequence:CCGGCGGCCTGTTCTACAGTATCTTCTCGAGAAGATACTGTAGAACAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009744.2-1424s1c1
Sequence:CCGGCCGGCTCAATAATCTCGTGAACTCGAGTTCACGAGATTATTGAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009744.2-2625s1c1
Sequence:CCGGGCTGTCAAAGAGAAGGCTTTACTCGAGTAAAGCCTTCTCTTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001706
VALIDATED
BCL6 MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001706.3-596s21c1
Sequence:CCGGTGTACACATCTCGGCTCAATTCTCGAGAATTGAGCCGAGATGTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001706.3-1650s21c1
Sequence:CCGGACAAGCCAGCCGGCTCAATAACTCGAGTTATTGAGCCGGCTGGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001706.3-2993s21c1
Sequence:CCGGACTGCGTTAAAGGCTCGATTTCTCGAGAAATCGAGCCTTTAACGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001706.2-2530s1c1
Sequence:CCGGCCCATGATGTAGTGCCTCTTTCTCGAGAAAGAGGCACTACATCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001706.2-1947s1c1
Sequence:CCGGCCACAGTGACAAACCCTACAACTCGAGTTGTAGGGTTTGTCACTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001706.2-491s1c1
Sequence:CCGGGCCTGTTCTATAGCATCTTTACTCGAGTAAAGATGCTATAGAACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001706.2-1659s1c1
Sequence:CCGGCCGGCTCAATAACATCGTTAACTCGAGTTAACGATGTTATTGAGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001706.2-707s1c1
Sequence:CCGGCCAGTGAAGCAGAGATGGTTTCTCGAGAAACCATCTCTGCTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001706
VALIDATED
BCL6 MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001706.3-596s21c1
Sequence:CCGGTGTACACATCTCGGCTCAATTCTCGAGAATTGAGCCGAGATGTGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001706.3-1650s21c1
Sequence:CCGGACAAGCCAGCCGGCTCAATAACTCGAGTTATTGAGCCGGCTGGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001706.3-2993s21c1
Sequence:CCGGACTGCGTTAAAGGCTCGATTTCTCGAGAAATCGAGCCTTTAACGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001706.2-2530s1c1
Sequence:CCGGCCCATGATGTAGTGCCTCTTTCTCGAGAAAGAGGCACTACATCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001706.2-1947s1c1
Sequence:CCGGCCACAGTGACAAACCCTACAACTCGAGTTGTAGGGTTTGTCACTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001706.2-491s1c1
Sequence:CCGGGCCTGTTCTATAGCATCTTTACTCGAGTAAAGATGCTATAGAACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001706.2-1659s1c1
Sequence:CCGGCCGGCTCAATAACATCGTTAACTCGAGTTAACGATGTTATTGAGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001706.2-707s1c1
Sequence:CCGGCCAGTGAAGCAGAGATGGTTTCTCGAGAAACCATCTCTGCTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001706
VALIDATED
BCL6 MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001706.3-596s21c1
Sequence:CCGGTGTACACATCTCGGCTCAATTCTCGAGAATTGAGCCGAGATGTGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001706.3-1650s21c1
Sequence:CCGGACAAGCCAGCCGGCTCAATAACTCGAGTTATTGAGCCGGCTGGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001706.3-2993s21c1
Sequence:CCGGACTGCGTTAAAGGCTCGATTTCTCGAGAAATCGAGCCTTTAACGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001706.2-2530s1c1
Sequence:CCGGCCCATGATGTAGTGCCTCTTTCTCGAGAAAGAGGCACTACATCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001706.2-1947s1c1
Sequence:CCGGCCACAGTGACAAACCCTACAACTCGAGTTGTAGGGTTTGTCACTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001706.2-491s1c1
Sequence:CCGGGCCTGTTCTATAGCATCTTTACTCGAGTAAAGATGCTATAGAACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001706.2-1659s1c1
Sequence:CCGGCCGGCTCAATAACATCGTTAACTCGAGTTAACGATGTTATTGAGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001706.2-707s1c1
Sequence:CCGGCCAGTGAAGCAGAGATGGTTTCTCGAGAAACCATCTCTGCTTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)