EMAIL THIS PAGE TO A FRIEND

BECN1

beclin 1, autophagy related

134 Gene Product Result for
Synonyms: ATG6 VPS30 beclin1
UniProtKB ID: Q14457, O75595, Q9UNA8
Gene ID:
Human(8678) Summary: Beclin-1 participates in the regulation of autophagy and has an important role in development, tumorigenesis, and neurodegeneration (Zhong et al., 2009 [PubMed 19270693]
Mouse(56208) beclin 1, autophagy related
Rat(114558) beclin 1, autophagy related
Zebrafish(393846) beclin 1 (coiled-coil, myosin-like BCL2 interacting protein)
chicken(420018) beclin 1, autophagy related
cow(527278) beclin 1, autophagy related
domestic cat(101101015) beclin 1, autophagy related
dog(480513) beclin 1, autophagy related
domestic guinea pig(100721231) beclin 1, autophagy related
naked mole-rat(101712212) beclin 1, autophagy related
sheep(100913170) beclin 1, autophagy related
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B6061 Anti-Beclin 1 (N-terminal) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
B6186 Anti-Beclin 1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB1306484 ANTI-BECLIN 1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
SAB1306271 ANTI-BECLIN 1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB1305637 ANTI-BECLIN 1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
PRS3611 Anti-Beclin-1 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, western blot pricing
PRS3613 Anti-Beclin-1 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306537 ANTI-BECLIN1-BH3 DOMAIN antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
HPA028949 Anti-BECN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103299 Anti-BECN1, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, rabbit, human
western blot pricing
SAB1305614 ANTI-PHOSPHO-BECLIN 1(S64) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305602 ANTI-PHOSPHO-BELCIN 1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB4100184 Monoclonal Anti-BECN1 antibody produced in mouse clone BECN1-B129, culture supernatant human
western blot pricing
SAB4100208 Monoclonal Anti-BECN1 antibody produced in mouse clone BECN1-A129, culture supernatant human
western blot pricing
SAB5300513 Monoclonal Anti-BECN1 antibody produced in mouse clone 2A4, ascites fluid human
ELISA, flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003766 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003766 Rosetta Predictions human pricing
NM_001034117 Rosetta Predictions rat pricing
NM_053739 Rosetta Predictions rat pricing
NM_019584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336256 predicted 652
2 SASI_Hs01_00090913 predicted 692
3 SASI_Hs01_00090914 predicted 1146
4 SASI_Hs01_00090916 predicted 1112
5 SASI_Hs01_00090917 predicted 1191
6 SASI_Hs01_00090918 predicted 839
7 SASI_Hs01_00090919 predicted 843
8 SASI_Hs02_00336257 predicted 1161
9 SASI_Hs01_00090920 predicted 997
10 SASI_Hs01_00090921 predicted 359
11 SASI_Hs01_00090915 predicted 407
12 SASI_Hs01_00090922 predicted 1222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076792 predicted 1032
2 SASI_Rn01_00076793 predicted 1227
3 SASI_Rn01_00076794 predicted 1557
4 SASI_Rn02_00203953 predicted 685
5 SASI_Rn01_00076795 predicted 1032
6 SASI_Rn01_00076796 predicted 1185
7 SASI_Rn01_00076797 predicted 1282
8 SASI_Rn01_00076798 predicted 1618
9 SASI_Rn01_00076799 predicted 1144
10 SASI_Rn01_00076800 predicted 1481
11 SASI_Rn01_00076801 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104466 predicted 1053
2 SASI_Rn01_00104467 predicted 1246
3 SASI_Rn01_00104468 predicted 1585
4 SASI_Rn02_00266521 predicted 702
5 SASI_Rn01_00104469 predicted 1052
6 SASI_Rn01_00104470 predicted 1211
7 SASI_Rn01_00104471 predicted 1303
8 SASI_Rn01_00104472 predicted 1640
9 SASI_Rn01_00104473 predicted 1168
10 SASI_Rn01_00104474 predicted 1504
11 SASI_Rn01_00104475 predicted 1624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048143 predicted 586
2 SASI_Mm01_00048144 predicted 973
3 SASI_Mm01_00048145 predicted 1530
4 SASI_Mm01_00048146 predicted 475
5 SASI_Mm01_00048147 predicted 1498
6 SASI_Mm01_00048148 predicted 806
7 SASI_Mm01_00048150 predicted 1566
8 SASI_Mm01_00048151 predicted 1559
9 SASI_Mm01_00048152 predicted 1410
10 SASI_Mm02_00324648 predicted 1530
11 SASI_Mm01_00048149 predicted 1222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019584
VALIDATED
BECN1 MISSION shRNA Bacterial Glycerol Stock
beclin 1, autophagy related
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019584.3-821s21c1
Sequence:CCGGAGCGGGAGTATAGTGAGTTTACTCGAGTAAACTCACTATACTCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019584.3-969s21c1
Sequence:CCGGCGGACAGTTTGGCACAATCAACTCGAGTTGATTGTGCCAAACTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019584.3-1574s21c1
Sequence:CCGGCCACATGTTTACAATACCAAACTCGAGTTTGGTATTGTAAACATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019584.3-1126s21c1
Sequence:CCGGCCCTATGGAAATCATTCCTATCTCGAGATAGGAATGATTTCCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-1575s1c1
Sequence:CCGGCCACATGTTTACAATACCAAACTCGAGTTTGGTATTGTAAACATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-1127s1c1
Sequence:CCGGCCCTATGGAAATCATTCCTATCTCGAGATAGGAATGATTTCCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-970s1c1
Sequence:CCGGCGGACAGTTTGGCACAATCAACTCGAGTTGATTGTGCCAAACTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-822s1c1
Sequence:CCGGAGCGGGAGTATAGTGAGTTTACTCGAGTAAACTCACTATACTCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-823s1c1
Sequence:CCGGGCGGGAGTATAGTGAGTTTAACTCGAGTTAAACTCACTATACTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019584
VALIDATED
BECN1 MISSION shRNA shRNA Plasmid DNA
beclin 1, autophagy related
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019584.3-821s21c1
Sequence:CCGGAGCGGGAGTATAGTGAGTTTACTCGAGTAAACTCACTATACTCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019584.3-969s21c1
Sequence:CCGGCGGACAGTTTGGCACAATCAACTCGAGTTGATTGTGCCAAACTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019584.3-1574s21c1
Sequence:CCGGCCACATGTTTACAATACCAAACTCGAGTTTGGTATTGTAAACATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019584.3-1126s21c1
Sequence:CCGGCCCTATGGAAATCATTCCTATCTCGAGATAGGAATGATTTCCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-1575s1c1
Sequence:CCGGCCACATGTTTACAATACCAAACTCGAGTTTGGTATTGTAAACATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-1127s1c1
Sequence:CCGGCCCTATGGAAATCATTCCTATCTCGAGATAGGAATGATTTCCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-970s1c1
Sequence:CCGGCGGACAGTTTGGCACAATCAACTCGAGTTGATTGTGCCAAACTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-822s1c1
Sequence:CCGGAGCGGGAGTATAGTGAGTTTACTCGAGTAAACTCACTATACTCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-823s1c1
Sequence:CCGGGCGGGAGTATAGTGAGTTTAACTCGAGTTAAACTCACTATACTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019584
VALIDATED
BECN1 MISSION shRNA Lentiviral Transduction Particles
beclin 1, autophagy related
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019584.3-821s21c1
Sequence:CCGGAGCGGGAGTATAGTGAGTTTACTCGAGTAAACTCACTATACTCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019584.3-969s21c1
Sequence:CCGGCGGACAGTTTGGCACAATCAACTCGAGTTGATTGTGCCAAACTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019584.3-1574s21c1
Sequence:CCGGCCACATGTTTACAATACCAAACTCGAGTTTGGTATTGTAAACATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019584.3-1126s21c1
Sequence:CCGGCCCTATGGAAATCATTCCTATCTCGAGATAGGAATGATTTCCATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-1575s1c1
Sequence:CCGGCCACATGTTTACAATACCAAACTCGAGTTTGGTATTGTAAACATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-1127s1c1
Sequence:CCGGCCCTATGGAAATCATTCCTATCTCGAGATAGGAATGATTTCCATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-970s1c1
Sequence:CCGGCGGACAGTTTGGCACAATCAACTCGAGTTGATTGTGCCAAACTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-822s1c1
Sequence:CCGGAGCGGGAGTATAGTGAGTTTACTCGAGTAAACTCACTATACTCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019584.2-823s1c1
Sequence:CCGGGCGGGAGTATAGTGAGTTTAACTCGAGTTAAACTCACTATACTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003766
VALIDATED
BECN1 MISSION shRNA Bacterial Glycerol Stock
beclin 1, autophagy related
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1483s21c1
Sequence:CCGGGCTTGGGTGTCCTCACAATTTCTCGAGAAATTGTGAGGACACCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1447s21c1
Sequence:CCGGCTCAAGTTCATGCTGACGAATCTCGAGATTCGTCAGCATGAACTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-418s21c1
Sequence:CCGGGCCAGGATGATGTCCACAGAACTCGAGTTCTGTGGACATCATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1051s21c1
Sequence:CCGGCCCGTGGAATGGAATGAGATTCTCGAGAATCTCATTCCATTCCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1146s21c1
Sequence:CCGGCCGACTTGTTCCTTACGGAAACTCGAGTTTCCGTAAGGAACAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1117s1c1
Sequence:CCGGCCGACTTGTTCCTTACGGAAACTCGAGTTTCCGTAAGGAACAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1022s1c1
Sequence:CCGGCCCGTGGAATGGAATGAGATTCTCGAGAATCTCATTCCATTCCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-389s1c1
Sequence:CCGGGCCAGGATGATGTCCACAGAACTCGAGTTCTGTGGACATCATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1454s1c1
Sequence:CCGGGCTTGGGTGTCCTCACAATTTCTCGAGAAATTGTGAGGACACCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1418s1c1
Sequence:CCGGCTCAAGTTCATGCTGACGAATCTCGAGATTCGTCAGCATGAACTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003766
VALIDATED
BECN1 MISSION shRNA shRNA Plasmid DNA
beclin 1, autophagy related
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1483s21c1
Sequence:CCGGGCTTGGGTGTCCTCACAATTTCTCGAGAAATTGTGAGGACACCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1447s21c1
Sequence:CCGGCTCAAGTTCATGCTGACGAATCTCGAGATTCGTCAGCATGAACTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-418s21c1
Sequence:CCGGGCCAGGATGATGTCCACAGAACTCGAGTTCTGTGGACATCATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1051s21c1
Sequence:CCGGCCCGTGGAATGGAATGAGATTCTCGAGAATCTCATTCCATTCCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1146s21c1
Sequence:CCGGCCGACTTGTTCCTTACGGAAACTCGAGTTTCCGTAAGGAACAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1117s1c1
Sequence:CCGGCCGACTTGTTCCTTACGGAAACTCGAGTTTCCGTAAGGAACAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1022s1c1
Sequence:CCGGCCCGTGGAATGGAATGAGATTCTCGAGAATCTCATTCCATTCCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-389s1c1
Sequence:CCGGGCCAGGATGATGTCCACAGAACTCGAGTTCTGTGGACATCATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1454s1c1
Sequence:CCGGGCTTGGGTGTCCTCACAATTTCTCGAGAAATTGTGAGGACACCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1418s1c1
Sequence:CCGGCTCAAGTTCATGCTGACGAATCTCGAGATTCGTCAGCATGAACTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003766
VALIDATED
BECN1 MISSION shRNA Lentiviral Transduction Particles
beclin 1, autophagy related
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1483s21c1
Sequence:CCGGGCTTGGGTGTCCTCACAATTTCTCGAGAAATTGTGAGGACACCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1447s21c1
Sequence:CCGGCTCAAGTTCATGCTGACGAATCTCGAGATTCGTCAGCATGAACTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-418s21c1
Sequence:CCGGGCCAGGATGATGTCCACAGAACTCGAGTTCTGTGGACATCATCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1051s21c1
Sequence:CCGGCCCGTGGAATGGAATGAGATTCTCGAGAATCTCATTCCATTCCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003766.3-1146s21c1
Sequence:CCGGCCGACTTGTTCCTTACGGAAACTCGAGTTTCCGTAAGGAACAAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1117s1c1
Sequence:CCGGCCGACTTGTTCCTTACGGAAACTCGAGTTTCCGTAAGGAACAAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1022s1c1
Sequence:CCGGCCCGTGGAATGGAATGAGATTCTCGAGAATCTCATTCCATTCCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-389s1c1
Sequence:CCGGGCCAGGATGATGTCCACAGAACTCGAGTTCTGTGGACATCATCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1454s1c1
Sequence:CCGGGCTTGGGTGTCCTCACAATTTCTCGAGAAATTGTGAGGACACCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003766.2-1418s1c1
Sequence:CCGGCTCAAGTTCATGCTGACGAATCTCGAGATTCGTCAGCATGAACTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)