EMAIL THIS PAGE TO A FRIEND

BEX1

brain expressed, X-linked 1

43 Gene Product Result for
Synonyms: BEX2 HBEX2 HGR74-h
UniProtKB ID: Q9HBH7, A0AVN1, A8K4J3, Q9NZ33
Gene ID:
Mouse(19716) brain expressed gene 1
Rat(501625) brain expressed, X-linked 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301166 ANTI-BEX1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018476 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018476 Rosetta Predictions human pricing
NM_001037365 Rosetta Predictions rat pricing
NM_009052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052058 predicted 245
2 SASI_Hs01_00052059 predicted 341
3 SASI_Hs01_00052060 predicted 342
4 SASI_Hs01_00052061 predicted 415
5 SASI_Hs01_00052062 predicted 413
6 SASI_Hs01_00052063 predicted 259
7 SASI_Hs01_00052064 predicted 412
8 SASI_Hs01_00052065 predicted 346
9 SASI_Hs01_00052066 predicted 251
10 SASI_Hs01_00052067 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112509 predicted 395
2 SASI_Rn01_00112510 predicted 390
3 SASI_Rn01_00112511 predicted 252
4 SASI_Rn01_00112513 predicted 598
5 SASI_Rn01_00112514 predicted 118
6 SASI_Rn01_00112516 predicted 121
7 SASI_Rn01_00112518 predicted 534
8 SASI_Rn02_00204418 predicted 588
9 SASI_Rn01_00112512 predicted 581
10 SASI_Rn02_00204419 predicted 587
11 SASI_Rn01_00112515 predicted 581
12 SASI_Rn01_00112517 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151691 predicted 333
2 SASI_Mm01_00151692 predicted 263
3 SASI_Mm01_00151693 predicted 265
4 SASI_Mm01_00151694 predicted 261
5 SASI_Mm01_00151696 predicted 676
6 SASI_Mm01_00151697 predicted 729
7 SASI_Mm01_00151698 predicted 736
8 SASI_Mm01_00151699 predicted 678
9 SASI_Mm01_00151700 predicted 805
10 SASI_Mm02_00315220 predicted 725
11 SASI_Mm01_00151695 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018476
VALIDATED
BEX1 MISSION shRNA Bacterial Glycerol Stock
brain expressed, X-linked 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018476.3-348s21c1
Sequence:CCGGCCCTTTGGATGCTGGTGAATACTCGAGTATTCACCAGCATCCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018476.3-632s21c1
Sequence:CCGGCCCTAAAGTTATTACGGAAACCTCGAGGTTTCCGTAATAACTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018476.3-266s21c1
Sequence:CCGGTAAACAGTCTCAGCATGGAAACTCGAGTTTCCATGCTGAGACTGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018476.3-664s21c1
Sequence:CCGGTTCGAATTTACATGTTCATGACTCGAGTCATGAACATGTAAATTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018476.3-681s21c1
Sequence:CCGGATGATGTGCCCTTGTTGTAAACTCGAGTTTACAACAAGGGCACATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018476.2-508s1c1
Sequence:CCGGCCTCACCATGACCATCATGATCTCGAGATCATGATGGTCATGGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018476.2-552s1c1
Sequence:CCGGCCTGATGGTTTCCCTAAAGTTCTCGAGAACTTTAGGGAAACCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018476.2-395s1c1
Sequence:CCGGCAAGGATGAGAGAAGAGAATACTCGAGTATTCTCTTCTCTCATCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018476.2-628s1c1
Sequence:CCGGGTAAACCTTTACCTGTCACTTCTCGAGAAGTGACAGGTAAAGGTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018476.2-351s1c1
Sequence:CCGGGCAGTATAGATGGGATATGATCTCGAGATCATATCCCATCTATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018476.2-295s1c1
Sequence:CCGGGAATACTGTGTGCCTAGAGGACTCGAGTCCTCTAGGCACACAGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018476.2-394s1c1
Sequence:CCGGGCAAGGATGAGAGAAGAGAATCTCGAGATTCTCTTCTCTCATCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018476
VALIDATED
BEX1 MISSION shRNA shRNA Plasmid DNA
brain expressed, X-linked 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018476.3-348s21c1
Sequence:CCGGCCCTTTGGATGCTGGTGAATACTCGAGTATTCACCAGCATCCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018476.3-632s21c1
Sequence:CCGGCCCTAAAGTTATTACGGAAACCTCGAGGTTTCCGTAATAACTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018476.3-266s21c1
Sequence:CCGGTAAACAGTCTCAGCATGGAAACTCGAGTTTCCATGCTGAGACTGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018476.3-664s21c1
Sequence:CCGGTTCGAATTTACATGTTCATGACTCGAGTCATGAACATGTAAATTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018476.3-681s21c1
Sequence:CCGGATGATGTGCCCTTGTTGTAAACTCGAGTTTACAACAAGGGCACATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018476.2-508s1c1
Sequence:CCGGCCTCACCATGACCATCATGATCTCGAGATCATGATGGTCATGGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018476.2-552s1c1
Sequence:CCGGCCTGATGGTTTCCCTAAAGTTCTCGAGAACTTTAGGGAAACCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018476.2-395s1c1
Sequence:CCGGCAAGGATGAGAGAAGAGAATACTCGAGTATTCTCTTCTCTCATCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018476.2-628s1c1
Sequence:CCGGGTAAACCTTTACCTGTCACTTCTCGAGAAGTGACAGGTAAAGGTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018476.2-351s1c1
Sequence:CCGGGCAGTATAGATGGGATATGATCTCGAGATCATATCCCATCTATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018476.2-295s1c1
Sequence:CCGGGAATACTGTGTGCCTAGAGGACTCGAGTCCTCTAGGCACACAGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018476.2-394s1c1
Sequence:CCGGGCAAGGATGAGAGAAGAGAATCTCGAGATTCTCTTCTCTCATCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018476
VALIDATED
BEX1 MISSION shRNA Lentiviral Transduction Particles
brain expressed, X-linked 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018476.3-348s21c1
Sequence:CCGGCCCTTTGGATGCTGGTGAATACTCGAGTATTCACCAGCATCCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018476.3-632s21c1
Sequence:CCGGCCCTAAAGTTATTACGGAAACCTCGAGGTTTCCGTAATAACTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018476.3-266s21c1
Sequence:CCGGTAAACAGTCTCAGCATGGAAACTCGAGTTTCCATGCTGAGACTGTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018476.3-664s21c1
Sequence:CCGGTTCGAATTTACATGTTCATGACTCGAGTCATGAACATGTAAATTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018476.3-681s21c1
Sequence:CCGGATGATGTGCCCTTGTTGTAAACTCGAGTTTACAACAAGGGCACATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018476.2-508s1c1
Sequence:CCGGCCTCACCATGACCATCATGATCTCGAGATCATGATGGTCATGGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018476.2-552s1c1
Sequence:CCGGCCTGATGGTTTCCCTAAAGTTCTCGAGAACTTTAGGGAAACCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018476.2-395s1c1
Sequence:CCGGCAAGGATGAGAGAAGAGAATACTCGAGTATTCTCTTCTCTCATCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018476.2-628s1c1
Sequence:CCGGGTAAACCTTTACCTGTCACTTCTCGAGAAGTGACAGGTAAAGGTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018476.2-351s1c1
Sequence:CCGGGCAGTATAGATGGGATATGATCTCGAGATCATATCCCATCTATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018476.2-295s1c1
Sequence:CCGGGAATACTGTGTGCCTAGAGGACTCGAGTCCTCTAGGCACACAGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018476.2-394s1c1
Sequence:CCGGGCAAGGATGAGAGAAGAGAATCTCGAGATTCTCTTCTCTCATCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009052
BEX1 MISSION shRNA Bacterial Glycerol Stock
brain expressed, X-linked 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009052.2-720s21c1
Sequence:CCGGTTATGTAGATCTCTCCCTGTTCTCGAGAACAGGGAGAGATCTACATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009052.2-683s21c1
Sequence:CCGGCTGCCTTGTGATGTACAAATTCTCGAGAATTTGTACATCACAAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009052.2-446s21c1
Sequence:CCGGGCTCACTATAGATGGGACCTGCTCGAGCAGGTCCCATCTATAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009052.2-438s21c1
Sequence:CCGGAGCCCATCGCTCACTATAGATCTCGAGATCTATAGTGAGCGATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009052.2-337s21c1
Sequence:CCGGGCCACAAGATACCATCAGAAGCTCGAGCTTCTGATGGTATCTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009052.2-738s1c1
Sequence:CCGGGTTACCAGCTTCTAATTGAAACTCGAGTTTCAATTAGAAGCTGGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009052.1-384s1c1
Sequence:CCGGCTATAGATGGGACCTGATGCACTCGAGTGCATCAGGTCCCATCTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009052.1-429s1c1
Sequence:CCGGGATGAGAGAGGAGAACGTACACTCGAGTGTACGTTCTCCTCTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009052
BEX1 MISSION shRNA shRNA Plasmid DNA
brain expressed, X-linked 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009052.2-720s21c1
Sequence:CCGGTTATGTAGATCTCTCCCTGTTCTCGAGAACAGGGAGAGATCTACATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009052.2-683s21c1
Sequence:CCGGCTGCCTTGTGATGTACAAATTCTCGAGAATTTGTACATCACAAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009052.2-446s21c1
Sequence:CCGGGCTCACTATAGATGGGACCTGCTCGAGCAGGTCCCATCTATAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009052.2-438s21c1
Sequence:CCGGAGCCCATCGCTCACTATAGATCTCGAGATCTATAGTGAGCGATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009052.2-337s21c1
Sequence:CCGGGCCACAAGATACCATCAGAAGCTCGAGCTTCTGATGGTATCTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009052.2-738s1c1
Sequence:CCGGGTTACCAGCTTCTAATTGAAACTCGAGTTTCAATTAGAAGCTGGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009052.1-384s1c1
Sequence:CCGGCTATAGATGGGACCTGATGCACTCGAGTGCATCAGGTCCCATCTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009052.1-429s1c1
Sequence:CCGGGATGAGAGAGGAGAACGTACACTCGAGTGTACGTTCTCCTCTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009052
BEX1 MISSION shRNA Lentiviral Transduction Particles
brain expressed, X-linked 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009052.2-720s21c1
Sequence:CCGGTTATGTAGATCTCTCCCTGTTCTCGAGAACAGGGAGAGATCTACATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009052.2-683s21c1
Sequence:CCGGCTGCCTTGTGATGTACAAATTCTCGAGAATTTGTACATCACAAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009052.2-446s21c1
Sequence:CCGGGCTCACTATAGATGGGACCTGCTCGAGCAGGTCCCATCTATAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009052.2-438s21c1
Sequence:CCGGAGCCCATCGCTCACTATAGATCTCGAGATCTATAGTGAGCGATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009052.2-337s21c1
Sequence:CCGGGCCACAAGATACCATCAGAAGCTCGAGCTTCTGATGGTATCTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009052.2-738s1c1
Sequence:CCGGGTTACCAGCTTCTAATTGAAACTCGAGTTTCAATTAGAAGCTGGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009052.1-384s1c1
Sequence:CCGGCTATAGATGGGACCTGATGCACTCGAGTGCATCAGGTCCCATCTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009052.1-429s1c1
Sequence:CCGGGATGAGAGAGGAGAACGTACACTCGAGTGTACGTTCTCCTCTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)