EMAIL THIS PAGE TO A FRIEND

BEX5

brain expressed, X-linked 5

46 Gene Product Result for
Synonyms: NGFRAP1L1
UniProtKB ID: Q5H9J7, Q569J0, Q56A74
Gene ID:
naked mole-rat(101726281) brain expressed, X-linked 5
sheep(101108890) brain expressed, X-linked 5
domestic cat(101089990) brain expressed, X-linked 5
cow(516056) brain expressed, X-linked 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012978 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129951 MISSION® esiRNA esiRNA human BEX5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012978 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110530 predicted 619
2 SASI_Hs02_00306276 predicted 559
3 SASI_Hs01_00110531 predicted 543
4 SASI_Hs01_00110532 predicted 550
5 SASI_Hs01_00110534 predicted 588
6 SASI_Hs01_00110535 predicted 560
7 SASI_Hs01_00110536 predicted 563
8 SASI_Hs01_00110537 predicted 562
9 SASI_Hs02_00306277 predicted 632
10 SASI_Hs01_00110538 predicted 624
11 SASI_Hs01_00110533 predicted 641
12 SASI_Hs01_00110539 predicted 594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012978
VALIDATED
BEX5 MISSION shRNA Bacterial Glycerol Stock
brain expressed, X-linked 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-595s1c1
Sequence:CCGGCCTCCTCACCATGATCATCATCTCGAGATGATGATCATGGTGAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-525s1c1
Sequence:CCGGGATGAGAGAGCTAAGGAGGAACTCGAGTTCCTCCTTAGCTCTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-553s1c1
Sequence:CCGGGAACTTCAGTTGAGGTACAGTCTCGAGACTGTACCTCAACTGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-666s1c1
Sequence:CCGGCCTGCTTTCTAAATTCGCATTCTCGAGAATGCGAATTTAGAAAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-478s1c1
Sequence:CCGGGATATGATAGATGGAGATGGACTCGAGTCCATCTCCATCTATCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-667s1c1
Sequence:CCGGCTGCTTTCTAAATTCGCATTTCTCGAGAAATGCGAATTTAGAAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-474s1c1
Sequence:CCGGCATTGATATGATAGATGGAGACTCGAGTCTCCATCTATCATATCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-462s1c1
Sequence:CCGGGCTTGTCGATAACATTGATATCTCGAGATATCAATGTTATCGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159765    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-696s1c1
Sequence:CCGGGTACCTTTAATGTGAACCTTTCTCGAGAAAGGTTCACATTAAAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-603s1c1
Sequence:CCGGCCATGATCATCATGATGAGTTCTCGAGAACTCATCATGATGATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-456s1c1
Sequence:CCGGCAATAGGCTTGTCGATAACATCTCGAGATGTTATCGACAAGCCTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-665s1c1
Sequence:CCGGCCCTGCTTTCTAAATTCGCATCTCGAGATGCGAATTTAGAAAGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012978
VALIDATED
BEX5 MISSION shRNA shRNA Plasmid DNA
brain expressed, X-linked 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-595s1c1
Sequence:CCGGCCTCCTCACCATGATCATCATCTCGAGATGATGATCATGGTGAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-525s1c1
Sequence:CCGGGATGAGAGAGCTAAGGAGGAACTCGAGTTCCTCCTTAGCTCTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-553s1c1
Sequence:CCGGGAACTTCAGTTGAGGTACAGTCTCGAGACTGTACCTCAACTGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-666s1c1
Sequence:CCGGCCTGCTTTCTAAATTCGCATTCTCGAGAATGCGAATTTAGAAAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-478s1c1
Sequence:CCGGGATATGATAGATGGAGATGGACTCGAGTCCATCTCCATCTATCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-667s1c1
Sequence:CCGGCTGCTTTCTAAATTCGCATTTCTCGAGAAATGCGAATTTAGAAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-474s1c1
Sequence:CCGGCATTGATATGATAGATGGAGACTCGAGTCTCCATCTATCATATCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-462s1c1
Sequence:CCGGGCTTGTCGATAACATTGATATCTCGAGATATCAATGTTATCGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159765    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-696s1c1
Sequence:CCGGGTACCTTTAATGTGAACCTTTCTCGAGAAAGGTTCACATTAAAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-603s1c1
Sequence:CCGGCCATGATCATCATGATGAGTTCTCGAGAACTCATCATGATGATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-456s1c1
Sequence:CCGGCAATAGGCTTGTCGATAACATCTCGAGATGTTATCGACAAGCCTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-665s1c1
Sequence:CCGGCCCTGCTTTCTAAATTCGCATCTCGAGATGCGAATTTAGAAAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012978
VALIDATED
BEX5 MISSION shRNA Lentiviral Transduction Particles
brain expressed, X-linked 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-595s1c1
Sequence:CCGGCCTCCTCACCATGATCATCATCTCGAGATGATGATCATGGTGAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-525s1c1
Sequence:CCGGGATGAGAGAGCTAAGGAGGAACTCGAGTTCCTCCTTAGCTCTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-553s1c1
Sequence:CCGGGAACTTCAGTTGAGGTACAGTCTCGAGACTGTACCTCAACTGAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-666s1c1
Sequence:CCGGCCTGCTTTCTAAATTCGCATTCTCGAGAATGCGAATTTAGAAAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-478s1c1
Sequence:CCGGGATATGATAGATGGAGATGGACTCGAGTCCATCTCCATCTATCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-667s1c1
Sequence:CCGGCTGCTTTCTAAATTCGCATTTCTCGAGAAATGCGAATTTAGAAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-474s1c1
Sequence:CCGGCATTGATATGATAGATGGAGACTCGAGTCTCCATCTATCATATCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-462s1c1
Sequence:CCGGGCTTGTCGATAACATTGATATCTCGAGATATCAATGTTATCGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159765    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-696s1c1
Sequence:CCGGGTACCTTTAATGTGAACCTTTCTCGAGAAAGGTTCACATTAAAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012978.1-603s1c1
Sequence:CCGGCCATGATCATCATGATGAGTTCTCGAGAACTCATCATGATGATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012978.1-456s1c1
Sequence:CCGGCAATAGGCTTGTCGATAACATCTCGAGATGTTATCGACAAGCCTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012978.1-665s1c1
Sequence:CCGGCCCTGCTTTCTAAATTCGCATCTCGAGATGCGAATTTAGAAAGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)