EMAIL THIS PAGE TO A FRIEND

BLOC1S6

biogenesis of lysosomal organelles complex-1, subunit 6, pallidin

213 Gene Product Result for
Synonyms: BLOS6 HPS9 PA PALLID PLDN
UniProtKB ID: Q9UL45
Gene ID:
Human(26258) Summary: The protein encoded by this gene may play a role in intracellular vesicle trafficking. It interacts with Syntaxin 13 which mediates intracellular membrane fusion. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(18457) biogenesis of organelles complex-1, subunit 6, pallidin
Rat(317630) biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
Zebrafish(791215) biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
cow(614408) pallidin homolog (mouse)
sheep(101113763) biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
domestic guinea pig(100735197) biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
naked mole-rat(101707035) biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012388 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012388 Rosetta Predictions human pricing
NM_001025714 Rosetta Predictions rat pricing
NM_019788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032649 predicted 1177
2 SASI_Hs01_00032650 predicted 378
3 SASI_Hs01_00032651 predicted 1226
4 SASI_Hs01_00032652 predicted 324
5 SASI_Hs01_00032653 predicted 299
6 SASI_Hs01_00032654 predicted 261
7 SASI_Hs02_00344196 predicted 996
8 SASI_Hs01_00032655 predicted 771
9 SASI_Hs01_00032656 predicted 817
10 SASI_Hs01_00032657 predicted 447
11 SASI_Hs01_00032658 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119264 predicted 948
2 SASI_Rn01_00119257 predicted 991
3 SASI_Rn01_00119258 predicted 875
4 SASI_Rn01_00119259 predicted 1000
5 SASI_Rn01_00119256 predicted 877
6 SASI_Rn01_00119260 predicted 741
7 SASI_Rn01_00119261 predicted 1089
8 SASI_Rn01_00119262 predicted 312
9 SASI_Rn01_00119263 predicted 301
10 SASI_Rn01_00119265 predicted 157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123392 predicted 756
2 SASI_Mm01_00123393 predicted 921
3 SASI_Mm01_00123394 predicted 856
4 SASI_Mm01_00123395 predicted 337
5 SASI_Mm01_00123396 predicted 1005
6 SASI_Mm01_00123397 predicted 919
7 SASI_Mm01_00123401 predicted 237
8 SASI_Mm02_00324999 predicted 409
9 SASI_Mm02_00325000 predicted 214
10 SASI_Mm02_00325001 predicted 763
11 SASI_Mm01_00123398 predicted 1195
12 SASI_Mm01_00123399 predicted 1241
13 SASI_Mm01_00123400 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012388
VALIDATED
BLOC1S6 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012388.2-2604s1c1
Sequence:CCGGGCAGACAATGTCACCTAAATTCTCGAGAATTTAGGTGACATTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012388.2-447s1c1
Sequence:CCGGCACACAGAACCAAGTTGTATTCTCGAGAATACAACTTGGTTCTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012388.2-383s1c1
Sequence:CCGGCAGAAGGATTGCTTTCTCATTCTCGAGAATGAGAAAGCAATCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012388.2-472s1c1
Sequence:CCGGGACACACTGGAACAAGAGATTCTCGAGAATCTCTTGTTCCAGTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_012388.2-3139s1c1
Sequence:CCGGCCCAGTAGACAGGCAATAGATCTCGAGATCTATTGCCTGTCTACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012388.2-862s1c1
Sequence:CCGGCCGGTATTACTGTGTCTCCATCTCGAGATGGAGACACAGTAATACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_012388.2-681s1c1
Sequence:CCGGGCAACGAGAGAAGGAGTTTGACTCGAGTCAAACTCCTTCTCTCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-300s21c1
Sequence:CCGGGACGCCTGGTTTAAGTGACACCTCGAGGTGTCACTTAAACCAGGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-684s21c1
Sequence:CCGGACGAGAGAAGGAGTTTGAAAGCTCGAGCTTTCAAACTCCTTCTCTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-347s21c1
Sequence:CCGGACTTGACTATAGAAGACAAAGCTCGAGCTTTGTCTTCTATAGTCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012388.2-850s21c1
Sequence:CCGGGAAATCCTTATTCCGGTATTACTCGAGTAATACCGGAATAAGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-387s21c1
Sequence:CCGGAGGATTGCTTTCTCATTATTTCTCGAGAAATAATGAGAAAGCAATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012388.2-1115s21c1
Sequence:CCGGGACTTGCCTTTCTGGTAATACCTCGAGGTATTACCAGAAAGGCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012388.2-819s21c1
Sequence:CCGGGGTAGTGCCTTATGCCATTATCTCGAGATAATGGCATAAGGCACTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012388
VALIDATED
BLOC1S6 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012388.2-2604s1c1
Sequence:CCGGGCAGACAATGTCACCTAAATTCTCGAGAATTTAGGTGACATTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012388.2-447s1c1
Sequence:CCGGCACACAGAACCAAGTTGTATTCTCGAGAATACAACTTGGTTCTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012388.2-383s1c1
Sequence:CCGGCAGAAGGATTGCTTTCTCATTCTCGAGAATGAGAAAGCAATCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012388.2-472s1c1
Sequence:CCGGGACACACTGGAACAAGAGATTCTCGAGAATCTCTTGTTCCAGTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_012388.2-3139s1c1
Sequence:CCGGCCCAGTAGACAGGCAATAGATCTCGAGATCTATTGCCTGTCTACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012388.2-862s1c1
Sequence:CCGGCCGGTATTACTGTGTCTCCATCTCGAGATGGAGACACAGTAATACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_012388.2-681s1c1
Sequence:CCGGGCAACGAGAGAAGGAGTTTGACTCGAGTCAAACTCCTTCTCTCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-300s21c1
Sequence:CCGGGACGCCTGGTTTAAGTGACACCTCGAGGTGTCACTTAAACCAGGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-684s21c1
Sequence:CCGGACGAGAGAAGGAGTTTGAAAGCTCGAGCTTTCAAACTCCTTCTCTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-347s21c1
Sequence:CCGGACTTGACTATAGAAGACAAAGCTCGAGCTTTGTCTTCTATAGTCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012388.2-850s21c1
Sequence:CCGGGAAATCCTTATTCCGGTATTACTCGAGTAATACCGGAATAAGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-387s21c1
Sequence:CCGGAGGATTGCTTTCTCATTATTTCTCGAGAAATAATGAGAAAGCAATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012388.2-1115s21c1
Sequence:CCGGGACTTGCCTTTCTGGTAATACCTCGAGGTATTACCAGAAAGGCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012388.2-819s21c1
Sequence:CCGGGGTAGTGCCTTATGCCATTATCTCGAGATAATGGCATAAGGCACTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012388
VALIDATED
BLOC1S6 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012388.2-2604s1c1
Sequence:CCGGGCAGACAATGTCACCTAAATTCTCGAGAATTTAGGTGACATTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012388.2-447s1c1
Sequence:CCGGCACACAGAACCAAGTTGTATTCTCGAGAATACAACTTGGTTCTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012388.2-383s1c1
Sequence:CCGGCAGAAGGATTGCTTTCTCATTCTCGAGAATGAGAAAGCAATCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012388.2-472s1c1
Sequence:CCGGGACACACTGGAACAAGAGATTCTCGAGAATCTCTTGTTCCAGTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_012388.2-3139s1c1
Sequence:CCGGCCCAGTAGACAGGCAATAGATCTCGAGATCTATTGCCTGTCTACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012388.2-862s1c1
Sequence:CCGGCCGGTATTACTGTGTCTCCATCTCGAGATGGAGACACAGTAATACCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_012388.2-681s1c1
Sequence:CCGGGCAACGAGAGAAGGAGTTTGACTCGAGTCAAACTCCTTCTCTCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-300s21c1
Sequence:CCGGGACGCCTGGTTTAAGTGACACCTCGAGGTGTCACTTAAACCAGGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-684s21c1
Sequence:CCGGACGAGAGAAGGAGTTTGAAAGCTCGAGCTTTCAAACTCCTTCTCTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-347s21c1
Sequence:CCGGACTTGACTATAGAAGACAAAGCTCGAGCTTTGTCTTCTATAGTCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012388.2-850s21c1
Sequence:CCGGGAAATCCTTATTCCGGTATTACTCGAGTAATACCGGAATAAGGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012388.2-387s21c1
Sequence:CCGGAGGATTGCTTTCTCATTATTTCTCGAGAAATAATGAGAAAGCAATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012388.2-1115s21c1
Sequence:CCGGGACTTGCCTTTCTGGTAATACCTCGAGGTATTACCAGAAAGGCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012388.2-819s21c1
Sequence:CCGGGGTAGTGCCTTATGCCATTATCTCGAGATAATGGCATAAGGCACTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019788
VALIDATED
BLOC1S6 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-751s1c1
Sequence:CCGGCTGTCCCACTACTTACCAGATCTCGAGATCTGGTAAGTAGTGGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-805s1c1
Sequence:CCGGACACAGAACCAAGTTGTGTTACTCGAGTAACACAACTTGGTTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-873s1c1
Sequence:CCGGCATGTTGGACATCAATGCTTTCTCGAGAAAGCATTGATGTCCAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-808s1c1
Sequence:CCGGCAGAACCAAGTTGTGTTACTACTCGAGTAGTAACACAACTTGGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019788.2-2345s1c1
Sequence:CCGGGCTTAAAGAAAGGCATAACTTCTCGAGAAGTTATGCCTTTCTTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-405s21c1
Sequence:GTACCGGACTCCATGTTGGACATCAATGCTCGAGCATTGATGTCCAACATGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-428s21c1
Sequence:GTACCGGTTGTTCACAGAGGCGAAGCACCTCGAGGTGCTTCGCCTCTGTGAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-239s21c1
Sequence:CCGGGACTTCCCTGTGGACGATAGACTCGAGTCTATCGTCCACAGGGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-216s21c1
Sequence:CCGGCTCCAGATGAAGGACTGATAGCTCGAGCTATCAGTCCTTCATCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-454s21c1
Sequence:CCGGCGCCAAGCTGGTGACTATAAGCTCGAGCTTATAGTCACCAGCTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-1881s21c1
Sequence:CCGGGCTTAAAGAAAGGCATAACTTCTCGAGAAGTTATGCCTTTCTTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-341s21c1
Sequence:CCGGACACAGAACCAAGTTGTGTTACTCGAGTAACACAACTTGGTTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-366s21c1
Sequence:GTACCGGATACACTGGAACAAGAGATTTCTCGAGAAATCTCTTGTTCCAGTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019788
VALIDATED
BLOC1S6 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-751s1c1
Sequence:CCGGCTGTCCCACTACTTACCAGATCTCGAGATCTGGTAAGTAGTGGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-805s1c1
Sequence:CCGGACACAGAACCAAGTTGTGTTACTCGAGTAACACAACTTGGTTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-873s1c1
Sequence:CCGGCATGTTGGACATCAATGCTTTCTCGAGAAAGCATTGATGTCCAACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-808s1c1
Sequence:CCGGCAGAACCAAGTTGTGTTACTACTCGAGTAGTAACACAACTTGGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019788.2-2345s1c1
Sequence:CCGGGCTTAAAGAAAGGCATAACTTCTCGAGAAGTTATGCCTTTCTTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-405s21c1
Sequence:GTACCGGACTCCATGTTGGACATCAATGCTCGAGCATTGATGTCCAACATGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-428s21c1
Sequence:GTACCGGTTGTTCACAGAGGCGAAGCACCTCGAGGTGCTTCGCCTCTGTGAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-239s21c1
Sequence:CCGGGACTTCCCTGTGGACGATAGACTCGAGTCTATCGTCCACAGGGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-216s21c1
Sequence:CCGGCTCCAGATGAAGGACTGATAGCTCGAGCTATCAGTCCTTCATCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-454s21c1
Sequence:CCGGCGCCAAGCTGGTGACTATAAGCTCGAGCTTATAGTCACCAGCTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-1881s21c1
Sequence:CCGGGCTTAAAGAAAGGCATAACTTCTCGAGAAGTTATGCCTTTCTTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-341s21c1
Sequence:CCGGACACAGAACCAAGTTGTGTTACTCGAGTAACACAACTTGGTTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-366s21c1
Sequence:GTACCGGATACACTGGAACAAGAGATTTCTCGAGAAATCTCTTGTTCCAGTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019788
VALIDATED
BLOC1S6 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-751s1c1
Sequence:CCGGCTGTCCCACTACTTACCAGATCTCGAGATCTGGTAAGTAGTGGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-805s1c1
Sequence:CCGGACACAGAACCAAGTTGTGTTACTCGAGTAACACAACTTGGTTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-873s1c1
Sequence:CCGGCATGTTGGACATCAATGCTTTCTCGAGAAAGCATTGATGTCCAACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019788.2-808s1c1
Sequence:CCGGCAGAACCAAGTTGTGTTACTACTCGAGTAGTAACACAACTTGGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019788.2-2345s1c1
Sequence:CCGGGCTTAAAGAAAGGCATAACTTCTCGAGAAGTTATGCCTTTCTTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-405s21c1
Sequence:GTACCGGACTCCATGTTGGACATCAATGCTCGAGCATTGATGTCCAACATGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-428s21c1
Sequence:GTACCGGTTGTTCACAGAGGCGAAGCACCTCGAGGTGCTTCGCCTCTGTGAACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-239s21c1
Sequence:CCGGGACTTCCCTGTGGACGATAGACTCGAGTCTATCGTCCACAGGGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-216s21c1
Sequence:CCGGCTCCAGATGAAGGACTGATAGCTCGAGCTATCAGTCCTTCATCTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-454s21c1
Sequence:CCGGCGCCAAGCTGGTGACTATAAGCTCGAGCTTATAGTCACCAGCTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-1881s21c1
Sequence:CCGGGCTTAAAGAAAGGCATAACTTCTCGAGAAGTTATGCCTTTCTTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-341s21c1
Sequence:CCGGACACAGAACCAAGTTGTGTTACTCGAGTAACACAACTTGGTTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019788.3-366s21c1
Sequence:GTACCGGATACACTGGAACAAGAGATTTCTCGAGAAATCTCTTGTTCCAGTGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)