EMAIL THIS PAGE TO A FRIEND

BMPR1A

bone morphogenetic protein receptor, type IA

175 Gene Product Result for
Synonyms: 10q23del ACVRLK3 ALK3 CD292 SKR5
UniProtKB ID: P36894, A8K6U9, Q8NEN8
Gene ID:
Human(657) Summary: The bone morphogenetic protein (BMP) receptors are a family of transmembrane serine/threonine kinases that include the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. These receptors are also closely related to the activin receptors, ACVR1 and ACVR2. The ligands of these receptors are members of the TGF-beta superfamily. TGF-betas and activins transduce their signals through the formation of heteromeric complexes with 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. [provided by RefSeq, Jul 2008]
Mouse(12166) bone morphogenetic protein receptor, type 1A
Rat(81507) bone morphogenetic protein receptor, type IA
Goat(100861241) bone morphogenetic protein receptor, type IA
sheep(101112282) bone morphogenetic protein receptor, type IA
Domestic Rabbit(100350518) bone morphogenetic protein receptor, type IA
naked mole-rat(101700899) bone morphogenetic protein receptor, type IA
domestic guinea pig(100723350) bone morphogenetic protein receptor, type IA
chicken(396308) bone morphogenetic protein receptor, type IA
cow(404101) bone morphogenetic protein receptor, type IA
Horse(100064367) bone morphogenetic protein receptor, type IA
domestic cat(101089548) bone morphogenetic protein receptor, type IA
dog(489077) bone morphogenetic protein receptor, type IA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1290 Human BMPR-IA ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004329 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004329 siRNAs that have been validated in the lab human pricing
NM_030849 Rosetta Predictions rat pricing
NM_009758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004329 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068951 validated 821
1 SASI_Hs01_00068950 validated 2241
1 SASI_Hs01_00068949 validated 1828
2 SASI_Hs02_00337373 predicted 2106
3 SASI_Hs02_00337374 predicted 611
4 SASI_Hs01_00068953 predicted 1937
5 SASI_Hs02_00337375 predicted 2144
6 SASI_Hs01_00068954 predicted 554
7 SASI_Hs02_00337376 predicted 1693
8 SASI_Hs02_00337377 predicted 1722
9 SASI_Hs01_00068958 predicted 2217
10 SASI_Hs01_00068952 predicted 1300
11 SASI_Hs01_00068955 predicted 1267
12 SASI_Hs01_00068956 predicted 1035
13 SASI_Hs01_00068957 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109917 predicted 645
2 SASI_Rn02_00264084 predicted 300
3 SASI_Rn02_00264085 predicted 903
4 SASI_Rn02_00264086 predicted 1389
5 SASI_Rn02_00264087 predicted 814
6 SASI_Rn02_00264088 predicted 1208
7 SASI_Rn02_00264089 predicted 696
8 SASI_Rn02_00264090 predicted 548
9 SASI_Rn02_00264091 predicted 855
10 SASI_Rn01_00109921 predicted 600
11 SASI_Rn01_00109916 predicted 496
12 SASI_Rn01_00109918 predicted 1674
13 SASI_Rn01_00109919 predicted 1839
14 SASI_Rn01_00109920 predicted 1038
15 SASI_Rn01_00109922 predicted 974
16 SASI_Rn01_00109923 predicted 1811
17 SASI_Rn01_00109924 predicted 611
18 SASI_Rn01_00109925 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172986 predicted 408
2 SASI_Mm01_00172987 predicted 558
3 SASI_Mm01_00172988 predicted 1082
4 SASI_Mm02_00316947 predicted 1757
5 SASI_Mm01_00172989 predicted 994
6 SASI_Mm01_00172990 predicted 963
7 SASI_Mm01_00172991 predicted 1389
8 SASI_Mm01_00172993 predicted 1465
9 SASI_Mm01_00172994 predicted 1042
10 SASI_Mm01_00172995 predicted 1359
11 SASI_Mm01_00172992 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009758
VALIDATED
BMPR1A MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein receptor, type IA
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009758.2-823s1c1
Sequence:CCGGCCCTGTTGTTATAGGTCCGTTCTCGAGAACGGACCTATAACAACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009758.2-656s1c1
Sequence:CCGGGCCATTATAGAAGAAGATGATCTCGAGATCATCTTCTTCTATAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009758.2-1642s1c1
Sequence:CCGGGCTGGATGAAAGCCTGAATAACTCGAGTTATTCAGGCTTTCATCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009758.2-687s1c1
Sequence:CCGGCCACATTAACTTCTGGGTGTACTCGAGTACACCCAGAAGTTAATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-964s21c1
Sequence:CCGGGGGTCGTTACAACCGTGATTTCTCGAGAAATCACGGTTGTAACGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-787s21c1
Sequence:CCGGCAATTTGTGCAACCAGTATTTCTCGAGAAATACTGGTTGCACAAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-2300s21c1
Sequence:CCGGTCAAGACTCCAATCCTGATAACTCGAGTTATCAGGATTGGAGTCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-1642s21c1
Sequence:CCGGGCTGGATGAAAGCCTGAATAACTCGAGTTATTCAGGCTTTCATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-687s21c1
Sequence:CCGGCCACATTAACTTCTGGGTGTACTCGAGTACACCCAGAAGTTAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009758
VALIDATED
BMPR1A MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein receptor, type IA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009758.2-823s1c1
Sequence:CCGGCCCTGTTGTTATAGGTCCGTTCTCGAGAACGGACCTATAACAACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009758.2-656s1c1
Sequence:CCGGGCCATTATAGAAGAAGATGATCTCGAGATCATCTTCTTCTATAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009758.2-1642s1c1
Sequence:CCGGGCTGGATGAAAGCCTGAATAACTCGAGTTATTCAGGCTTTCATCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009758.2-687s1c1
Sequence:CCGGCCACATTAACTTCTGGGTGTACTCGAGTACACCCAGAAGTTAATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-964s21c1
Sequence:CCGGGGGTCGTTACAACCGTGATTTCTCGAGAAATCACGGTTGTAACGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-787s21c1
Sequence:CCGGCAATTTGTGCAACCAGTATTTCTCGAGAAATACTGGTTGCACAAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-2300s21c1
Sequence:CCGGTCAAGACTCCAATCCTGATAACTCGAGTTATCAGGATTGGAGTCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-1642s21c1
Sequence:CCGGGCTGGATGAAAGCCTGAATAACTCGAGTTATTCAGGCTTTCATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-687s21c1
Sequence:CCGGCCACATTAACTTCTGGGTGTACTCGAGTACACCCAGAAGTTAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009758
VALIDATED
BMPR1A MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein receptor, type IA
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009758.2-823s1c1
Sequence:CCGGCCCTGTTGTTATAGGTCCGTTCTCGAGAACGGACCTATAACAACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009758.2-656s1c1
Sequence:CCGGGCCATTATAGAAGAAGATGATCTCGAGATCATCTTCTTCTATAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009758.2-1642s1c1
Sequence:CCGGGCTGGATGAAAGCCTGAATAACTCGAGTTATTCAGGCTTTCATCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009758.2-687s1c1
Sequence:CCGGCCACATTAACTTCTGGGTGTACTCGAGTACACCCAGAAGTTAATGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-964s21c1
Sequence:CCGGGGGTCGTTACAACCGTGATTTCTCGAGAAATCACGGTTGTAACGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-787s21c1
Sequence:CCGGCAATTTGTGCAACCAGTATTTCTCGAGAAATACTGGTTGCACAAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-2300s21c1
Sequence:CCGGTCAAGACTCCAATCCTGATAACTCGAGTTATCAGGATTGGAGTCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-1642s21c1
Sequence:CCGGGCTGGATGAAAGCCTGAATAACTCGAGTTATTCAGGCTTTCATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009758.4-687s21c1
Sequence:CCGGCCACATTAACTTCTGGGTGTACTCGAGTACACCCAGAAGTTAATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004329
VALIDATED
BMPR1A MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein receptor, type IA
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.x-2565s1c1
Sequence:CCGGCGCCAATCTCATACAAGCCATCTCGAGATGGCTTGTATGAGATTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.x-1777s1c1
Sequence:CCGGGATGAATGTCTACGAGCAGTTCTCGAGAACTGCTCGTAGACATTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.x-509s1c1
Sequence:CCGGGTCCAGATGATGCTATTAATACTCGAGTATTAATAGCATCATCTGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004329.2-1036s1c1
Sequence:CCGGGCATAATTGCTATGATCATCTCTCGAGAGATGATCATAGCAATTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004329.2-1538s1c1
Sequence:CCGGCCTGCTTAAATTGGCTTATTCCTCGAGGAATAAGCCAATTTAAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.2-2082s1c1
Sequence:CCGGCTCACAGCATTGAGAATTAAGCTCGAGCTTAATTCTCAATGCTGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.2-593s1c1
Sequence:CCGGGTTCATCATTTCTCGTGTTCACTCGAGTGAACACGAGAAATGATGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004329.2-1698s1c1
Sequence:CCGGGCTGTTAAATTCAACAGTGACCTCGAGGTCACTGTTGAATTTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004329.2-775s1c1
Sequence:CCGGGCATAACTAATGGACATTGCTCTCGAGAGCAATGTCCATTAGTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-1119s21c1
Sequence:CCGGCGTGATTTGGAACAGGATGAACTCGAGTTCATCCTGTTCCAAATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-2016s21c1
Sequence:CCGGGATGAATGTCTACGAGCAGTTCTCGAGAACTGCTCGTAGACATTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004329.2-748s21c1
Sequence:CCGGGTCCAGATGATGCTATTAATACTCGAGTATTAATAGCATCATCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-593s21c1
Sequence:CCGGGTTCATCATTTCTCGTGTTCACTCGAGTGAACACGAGAAATGATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-2082s21c1
Sequence:CCGGCTCACAGCATTGAGAATTAAGCTCGAGCTTAATTCTCAATGCTGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004329
VALIDATED
BMPR1A MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein receptor, type IA
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.x-2565s1c1
Sequence:CCGGCGCCAATCTCATACAAGCCATCTCGAGATGGCTTGTATGAGATTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.x-1777s1c1
Sequence:CCGGGATGAATGTCTACGAGCAGTTCTCGAGAACTGCTCGTAGACATTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.x-509s1c1
Sequence:CCGGGTCCAGATGATGCTATTAATACTCGAGTATTAATAGCATCATCTGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004329.2-1036s1c1
Sequence:CCGGGCATAATTGCTATGATCATCTCTCGAGAGATGATCATAGCAATTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004329.2-1538s1c1
Sequence:CCGGCCTGCTTAAATTGGCTTATTCCTCGAGGAATAAGCCAATTTAAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.2-2082s1c1
Sequence:CCGGCTCACAGCATTGAGAATTAAGCTCGAGCTTAATTCTCAATGCTGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.2-593s1c1
Sequence:CCGGGTTCATCATTTCTCGTGTTCACTCGAGTGAACACGAGAAATGATGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004329.2-1698s1c1
Sequence:CCGGGCTGTTAAATTCAACAGTGACCTCGAGGTCACTGTTGAATTTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004329.2-775s1c1
Sequence:CCGGGCATAACTAATGGACATTGCTCTCGAGAGCAATGTCCATTAGTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-1119s21c1
Sequence:CCGGCGTGATTTGGAACAGGATGAACTCGAGTTCATCCTGTTCCAAATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-2016s21c1
Sequence:CCGGGATGAATGTCTACGAGCAGTTCTCGAGAACTGCTCGTAGACATTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004329.2-748s21c1
Sequence:CCGGGTCCAGATGATGCTATTAATACTCGAGTATTAATAGCATCATCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-593s21c1
Sequence:CCGGGTTCATCATTTCTCGTGTTCACTCGAGTGAACACGAGAAATGATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-2082s21c1
Sequence:CCGGCTCACAGCATTGAGAATTAAGCTCGAGCTTAATTCTCAATGCTGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004329
VALIDATED
BMPR1A MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein receptor, type IA
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.x-2565s1c1
Sequence:CCGGCGCCAATCTCATACAAGCCATCTCGAGATGGCTTGTATGAGATTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.x-1777s1c1
Sequence:CCGGGATGAATGTCTACGAGCAGTTCTCGAGAACTGCTCGTAGACATTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.x-509s1c1
Sequence:CCGGGTCCAGATGATGCTATTAATACTCGAGTATTAATAGCATCATCTGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004329.2-1036s1c1
Sequence:CCGGGCATAATTGCTATGATCATCTCTCGAGAGATGATCATAGCAATTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004329.2-1538s1c1
Sequence:CCGGCCTGCTTAAATTGGCTTATTCCTCGAGGAATAAGCCAATTTAAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.2-2082s1c1
Sequence:CCGGCTCACAGCATTGAGAATTAAGCTCGAGCTTAATTCTCAATGCTGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004329.2-593s1c1
Sequence:CCGGGTTCATCATTTCTCGTGTTCACTCGAGTGAACACGAGAAATGATGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004329.2-1698s1c1
Sequence:CCGGGCTGTTAAATTCAACAGTGACCTCGAGGTCACTGTTGAATTTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004329.2-775s1c1
Sequence:CCGGGCATAACTAATGGACATTGCTCTCGAGAGCAATGTCCATTAGTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-1119s21c1
Sequence:CCGGCGTGATTTGGAACAGGATGAACTCGAGTTCATCCTGTTCCAAATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-2016s21c1
Sequence:CCGGGATGAATGTCTACGAGCAGTTCTCGAGAACTGCTCGTAGACATTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004329.2-748s21c1
Sequence:CCGGGTCCAGATGATGCTATTAATACTCGAGTATTAATAGCATCATCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-593s21c1
Sequence:CCGGGTTCATCATTTCTCGTGTTCACTCGAGTGAACACGAGAAATGATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004329.2-2082s21c1
Sequence:CCGGCTCACAGCATTGAGAATTAAGCTCGAGCTTAATTCTCAATGCTGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)