EMAIL THIS PAGE TO A FRIEND

BOLA1

bolA family member 1

52 Gene Product Result for
UniProtKB ID: Q9Y3E2, B2R7K2, D3DUZ4, Q5QNY0
Gene ID:
Mouse(69168) bolA-like 1 (E. coli)
Rat(365875) bolA homolog 1 (E. coli)
Zebrafish(445163) bolA homolog 1 (E. coli)
dog(475832) bolA homolog 1 (E. coli)
domestic cat(101081319) bolA homolog 1 (E. coli)
cow(509530) bolA homolog 1 (E. coli)
sheep(101123165) bolA homolog 1 (E. coli)
domestic guinea pig(100716957) bolA homolog 1 (E. coli)
naked mole-rat(101710835) bolA homolog 1 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016074 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016074 Rosetta Predictions human pricing
NM_001071776 Rosetta Predictions rat pricing
NM_026975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104938 predicted 549
2 SASI_Hs01_00104939 predicted 532
3 SASI_Hs01_00104940 predicted 276
4 SASI_Hs01_00104941 predicted 255
5 SASI_Hs01_00104942 predicted 542
6 SASI_Hs01_00104944 predicted 561
7 SASI_Hs01_00104945 predicted 518
8 SASI_Hs01_00104946 predicted 277
9 SASI_Hs01_00104947 predicted 268
10 SASI_Hs02_00348817 predicted 536
11 SASI_Hs01_00104943 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001071776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207442 predicted 475
2 SASI_Rn02_00207443 predicted 496
3 SASI_Rn02_00207444 predicted 339
4 SASI_Rn02_00207445 predicted 506
5 SASI_Rn02_00207446 predicted 502
6 SASI_Rn02_00207447 predicted 319
7 SASI_Rn02_00207448 predicted 507
8 SASI_Rn02_00207449 predicted 493
9 SASI_Rn02_00207450 predicted 299
10 SASI_Rn02_00207451 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041034 predicted 506
2 SASI_Mm01_00041036 predicted 339
3 SASI_Mm02_00331291 predicted 434
4 SASI_Mm02_00331292 predicted 203
5 SASI_Mm02_00331293 predicted 239
6 SASI_Mm02_00331294 predicted 491
7 SASI_Mm02_00331295 predicted 332
8 SASI_Mm01_00041035 predicted 412
9 SASI_Mm01_00041037 predicted 387
10 SASI_Mm01_00041038 predicted 315
11 SASI_Mm01_00041039 predicted 494
12 SASI_Mm01_00041040 predicted 300
13 SASI_Mm01_00041041 predicted 225
14 SASI_Mm01_00041042 predicted 251
15 SASI_Mm01_00041043 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016074
VALIDATED
BOLA1 MISSION shRNA Bacterial Glycerol Stock
bolA family member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_016074.3-662s21c1
Sequence:CCGGATACATACTCTCCGAAGATAGCTCGAGCTATCTTCGGAGAGTATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016074.3-223s21c1
Sequence:CCGGCGCCATTCGCACGAAGTTGGACTCGAGTCCAACTTCGTGCGAATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016074.3-304s21c1
Sequence:CCGGGCCTGGCAGTGAGACTCACTTCTCGAGAAGTGAGTCTCACTGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_016074.3-493s21c1
Sequence:CCGGCCCATGCCTGGGTGGGAACAACTCGAGTTGTTCCCACCCAGGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016074.3-259s21c1
Sequence:CCGGCGAGGTGCTAGAGCTTCGCAACTCGAGTTGCGAAGCTCTAGCACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-214s1c1
Sequence:CCGGCGAGGTGCTAGAGCTTCGCAACTCGAGTTGCGAAGCTCTAGCACCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-448s1c1
Sequence:CCGGCCCATGCCTGGGTGGGAACAACTCGAGTTGTTCCCACCCAGGCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-178s1c1
Sequence:CCGGCGCCATTCGCACGAAGTTGGACTCGAGTCCAACTTCGTGCGAATGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-297s1c1
Sequence:CCGGGCTCTCGTTTCGAGGGACTGACTCGAGTCAGTCCCTCGAAACGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016074
VALIDATED
BOLA1 MISSION shRNA shRNA Plasmid DNA
bolA family member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_016074.3-662s21c1
Sequence:CCGGATACATACTCTCCGAAGATAGCTCGAGCTATCTTCGGAGAGTATGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016074.3-223s21c1
Sequence:CCGGCGCCATTCGCACGAAGTTGGACTCGAGTCCAACTTCGTGCGAATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016074.3-304s21c1
Sequence:CCGGGCCTGGCAGTGAGACTCACTTCTCGAGAAGTGAGTCTCACTGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_016074.3-493s21c1
Sequence:CCGGCCCATGCCTGGGTGGGAACAACTCGAGTTGTTCCCACCCAGGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016074.3-259s21c1
Sequence:CCGGCGAGGTGCTAGAGCTTCGCAACTCGAGTTGCGAAGCTCTAGCACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-214s1c1
Sequence:CCGGCGAGGTGCTAGAGCTTCGCAACTCGAGTTGCGAAGCTCTAGCACCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-448s1c1
Sequence:CCGGCCCATGCCTGGGTGGGAACAACTCGAGTTGTTCCCACCCAGGCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-178s1c1
Sequence:CCGGCGCCATTCGCACGAAGTTGGACTCGAGTCCAACTTCGTGCGAATGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-297s1c1
Sequence:CCGGGCTCTCGTTTCGAGGGACTGACTCGAGTCAGTCCCTCGAAACGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016074
VALIDATED
BOLA1 MISSION shRNA Lentiviral Transduction Particles
bolA family member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_016074.3-662s21c1
Sequence:CCGGATACATACTCTCCGAAGATAGCTCGAGCTATCTTCGGAGAGTATGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016074.3-223s21c1
Sequence:CCGGCGCCATTCGCACGAAGTTGGACTCGAGTCCAACTTCGTGCGAATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016074.3-304s21c1
Sequence:CCGGGCCTGGCAGTGAGACTCACTTCTCGAGAAGTGAGTCTCACTGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_016074.3-493s21c1
Sequence:CCGGCCCATGCCTGGGTGGGAACAACTCGAGTTGTTCCCACCCAGGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016074.3-259s21c1
Sequence:CCGGCGAGGTGCTAGAGCTTCGCAACTCGAGTTGCGAAGCTCTAGCACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-214s1c1
Sequence:CCGGCGAGGTGCTAGAGCTTCGCAACTCGAGTTGCGAAGCTCTAGCACCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-448s1c1
Sequence:CCGGCCCATGCCTGGGTGGGAACAACTCGAGTTGTTCCCACCCAGGCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-178s1c1
Sequence:CCGGCGCCATTCGCACGAAGTTGGACTCGAGTCCAACTTCGTGCGAATGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016074.1-297s1c1
Sequence:CCGGGCTCTCGTTTCGAGGGACTGACTCGAGTCAGTCCCTCGAAACGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026975
VALIDATED
BOLA1 MISSION shRNA Bacterial Glycerol Stock
bolA family member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026975.2-139s21c1
Sequence:CCGGAGCCGCTATTCGCGCCAAATTCTCGAGAATTTGGCGCGAATAGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026975.2-508s21c1
Sequence:CCGGTACATCACTACTACCTTATTCCTCGAGGAATAAGGTAGTAGTGATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026975.2-223s21c1
Sequence:CCGGAGCAGGCAGCGAGACGCATTTCTCGAGAAATGCGTCTCGCTGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026975.2-416s21c1
Sequence:CCGGTGCCTAGGTGGGAGCAAGAAACTCGAGTTTCTTGCTCCCACCTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026975.2-449s21c1
Sequence:CCGGTCTTAATAAATACCTGGATTGCTCGAGCAATCCAGGTATTTATTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026975
VALIDATED
BOLA1 MISSION shRNA shRNA Plasmid DNA
bolA family member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026975.2-139s21c1
Sequence:CCGGAGCCGCTATTCGCGCCAAATTCTCGAGAATTTGGCGCGAATAGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026975.2-508s21c1
Sequence:CCGGTACATCACTACTACCTTATTCCTCGAGGAATAAGGTAGTAGTGATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026975.2-223s21c1
Sequence:CCGGAGCAGGCAGCGAGACGCATTTCTCGAGAAATGCGTCTCGCTGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026975.2-416s21c1
Sequence:CCGGTGCCTAGGTGGGAGCAAGAAACTCGAGTTTCTTGCTCCCACCTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026975.2-449s21c1
Sequence:CCGGTCTTAATAAATACCTGGATTGCTCGAGCAATCCAGGTATTTATTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026975
VALIDATED
BOLA1 MISSION shRNA Lentiviral Transduction Particles
bolA family member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026975.2-139s21c1
Sequence:CCGGAGCCGCTATTCGCGCCAAATTCTCGAGAATTTGGCGCGAATAGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026975.2-508s21c1
Sequence:CCGGTACATCACTACTACCTTATTCCTCGAGGAATAAGGTAGTAGTGATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026975.2-223s21c1
Sequence:CCGGAGCAGGCAGCGAGACGCATTTCTCGAGAAATGCGTCTCGCTGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026975.2-416s21c1
Sequence:CCGGTGCCTAGGTGGGAGCAAGAAACTCGAGTTTCTTGCTCCCACCTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026975.2-449s21c1
Sequence:CCGGTCTTAATAAATACCTGGATTGCTCGAGCAATCCAGGTATTTATTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)