EMAIL THIS PAGE TO A FRIEND

BOLA2B

bolA family member 2B

23 Gene Product Result for
Synonyms: BOLA2
Gene ID:
Human(654483) Summary: This gene is located within a region of a segmental duplication on chromosome 16p. The product of this gene belongs to the eukaryotic subfamily of the BolA-like proteins. This gene encodes the BolA-like protein 2. The BolA-like proteins are widely conserved from prokaryotes to eukaryotes, and these proteins seem to be involved in cell proliferation or cell-cycle regulation. This duplicated region contains a complete copy of the short splice variant of the BOLA2 gene and a partial copy of the long splice variant of the BOLA2 gene. [provided by RefSeq, Jul 2008]
domestic cat(101088204) bolA homolog 2B (E. coli)
cow(614731) bolA homolog 2B (E. coli)
sheep(101114744) bolA homolog 2B (E. coli)
domestic guinea pig(100725158) bolA homolog 2B (E. coli)
naked mole-rat(101696427) bolA homolog 2B (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039182 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117291 MISSION® esiRNA esiRNA human BOLA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039182 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308446 predicted 720
2 SASI_Hs02_00308447 predicted 704
3 SASI_Hs02_00308448 predicted 720
4 SASI_Hs01_00229482 predicted 559
5 SASI_Hs02_00308449 predicted 718
6 SASI_Hs01_00229484 predicted 559
7 SASI_Hs02_00308450 predicted 776
8 SASI_Hs02_00308451 predicted 721
9 SASI_Hs02_00308452 predicted 705
10 SASI_Hs01_00229485 predicted 573
11 SASI_Hs01_00229477 predicted 612
12 SASI_Hs01_00229478 predicted 544
13 SASI_Hs01_00229479 predicted 570
14 SASI_Hs01_00229480 predicted 569
15 SASI_Hs01_00229481 predicted 611
16 SASI_Hs01_00229483 predicted 581
17 SASI_Hs01_00229486 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039182
BOLA2B MISSION shRNA Bacterial Glycerol Stock
bolA family member 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-574s21c1
Sequence:CCGGGCGTTGACGTACGCCTTAGTACTCGAGTACTAAGGCGTACGTCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-794s21c1
Sequence:CCGGTCAACCGTTGCTCCTGTAGCTCTCGAGAGCTACAGGAGCAACGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-591s21c1
Sequence:CCGGAGTAAGGGCGGAAGTGAGTTTCTCGAGAAACTCACTTCCGCCCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-712s21c1
Sequence:CCGGATGGAACTCAGCGCCGAATACCTCGAGGTATTCGGCGCTGAGTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-627s21c1
Sequence:CCGGTCCTGTAAGGCAGCAAGGTAGCTCGAGCTACCTTGCTGCCTTACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039182
BOLA2B MISSION shRNA shRNA Plasmid DNA
bolA family member 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-574s21c1
Sequence:CCGGGCGTTGACGTACGCCTTAGTACTCGAGTACTAAGGCGTACGTCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-794s21c1
Sequence:CCGGTCAACCGTTGCTCCTGTAGCTCTCGAGAGCTACAGGAGCAACGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-591s21c1
Sequence:CCGGAGTAAGGGCGGAAGTGAGTTTCTCGAGAAACTCACTTCCGCCCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-712s21c1
Sequence:CCGGATGGAACTCAGCGCCGAATACCTCGAGGTATTCGGCGCTGAGTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-627s21c1
Sequence:CCGGTCCTGTAAGGCAGCAAGGTAGCTCGAGCTACCTTGCTGCCTTACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039182
BOLA2B MISSION shRNA Lentiviral Transduction Particles
bolA family member 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-574s21c1
Sequence:CCGGGCGTTGACGTACGCCTTAGTACTCGAGTACTAAGGCGTACGTCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-794s21c1
Sequence:CCGGTCAACCGTTGCTCCTGTAGCTCTCGAGAGCTACAGGAGCAACGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-591s21c1
Sequence:CCGGAGTAAGGGCGGAAGTGAGTTTCTCGAGAAACTCACTTCCGCCCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-712s21c1
Sequence:CCGGATGGAACTCAGCGCCGAATACCTCGAGGTATTCGGCGCTGAGTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039182.1-627s21c1
Sequence:CCGGTCCTGTAAGGCAGCAAGGTAGCTCGAGCTACCTTGCTGCCTTACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)