EMAIL THIS PAGE TO A FRIEND

BPIFA2

BPI fold containing family A, member 2

54 Gene Product Result for
Synonyms: C20orf70 PSP SPLUNC2 bA49G10.1
UniProtKB ID: Q96DR5, Q9BQQ0
Gene ID:
Mouse(19194) BPI fold containing family A, member 2
Rat(50585) BPI fold containing family A, member 2
dog(608599) BPI fold containing family A, member 2
Horse(100034112) BPI fold containing family A, member 2
domestic cat(101099708) BPI fold containing family A, member 2
naked mole-rat(101705767) BPI fold containing family A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080574 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080574 Rosetta Predictions human pricing
NM_052808 Rosetta Predictions rat pricing
NM_008953 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075374 predicted 797
2 SASI_Hs01_00075375 predicted 638
3 SASI_Hs01_00075376 predicted 479
4 SASI_Hs01_00075378 predicted 220
5 SASI_Hs01_00075379 predicted 715
6 SASI_Hs01_00075380 predicted 795
7 SASI_Hs01_00075381 predicted 518
8 SASI_Hs01_00075382 predicted 770
9 SASI_Hs02_00362314 predicted 450
10 SASI_Hs01_00075383 predicted 586
11 SASI_Hs01_00075377 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099111 predicted 293
2 SASI_Rn01_00099112 predicted 734
3 SASI_Rn02_00265614 predicted 622
4 SASI_Rn01_00099113 predicted 583
5 SASI_Rn01_00099114 predicted 677
6 SASI_Rn01_00099115 predicted 566
7 SASI_Rn01_00099116 predicted 272
8 SASI_Rn01_00099117 predicted 286
9 SASI_Rn01_00099118 predicted 696
10 SASI_Rn01_00099119 predicted 604
11 SASI_Rn01_00099120 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140768 predicted 450
2 SASI_Mm01_00140769 predicted 641
3 SASI_Mm01_00140770 predicted 285
4 SASI_Mm01_00140771 predicted 602
5 SASI_Mm01_00140772 predicted 594
6 SASI_Mm01_00140773 predicted 510
7 SASI_Mm01_00140774 predicted 729
8 SASI_Mm01_00140775 predicted 558
9 SASI_Mm01_00140776 predicted 221
10 SASI_Mm02_00315019 predicted 282
11 SASI_Mm01_00140777 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080574
BPIFA2 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family A, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000151615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-204s1c1
Sequence:CCGGGAGACAGTTGACAATACTCTTCTCGAGAAGAGTATTGTCAACTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080574.2-534s1c1
Sequence:CCGGGCAGTCACAATTGAAACTGATCTCGAGATCAGTTTCAATTGTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080574.2-132s1c1
Sequence:CCGGCTTCTTGACAATCTTGGCAATCTCGAGATTGCCAAGATTGTCAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-710s1c1
Sequence:CCGGGAAGGAGATATGTCCACTGATCTCGAGATCAGTGGACATATCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-777s1c1
Sequence:CCGGGTCGATAATCCTCAGCACAAACTCGAGTTTGTGCTGAGGATTATCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-776s1c1
Sequence:CCGGCGTCGATAATCCTCAGCACAACTCGAGTTGTGCTGAGGATTATCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-155s21c1
Sequence:CCGGCCTAAGCAATGTCGTGGATAACTCGAGTTATCCACGACATTGCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-646s21c1
Sequence:CCGGTCATCAACAAGTTCGTGAATACTCGAGTATTCACGAACTTGTTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-483s21c1
Sequence:CCGGCCCATCATTGGCCAGATTATCCTCGAGGATAATCTGGCCAATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-530s21c1
Sequence:CCGGGACCGCAGTCACAATTGAAACCTCGAGGTTTCAATTGTGACTGCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080574
BPIFA2 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family A, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000151615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-204s1c1
Sequence:CCGGGAGACAGTTGACAATACTCTTCTCGAGAAGAGTATTGTCAACTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080574.2-534s1c1
Sequence:CCGGGCAGTCACAATTGAAACTGATCTCGAGATCAGTTTCAATTGTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080574.2-132s1c1
Sequence:CCGGCTTCTTGACAATCTTGGCAATCTCGAGATTGCCAAGATTGTCAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-710s1c1
Sequence:CCGGGAAGGAGATATGTCCACTGATCTCGAGATCAGTGGACATATCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-777s1c1
Sequence:CCGGGTCGATAATCCTCAGCACAAACTCGAGTTTGTGCTGAGGATTATCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-776s1c1
Sequence:CCGGCGTCGATAATCCTCAGCACAACTCGAGTTGTGCTGAGGATTATCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-155s21c1
Sequence:CCGGCCTAAGCAATGTCGTGGATAACTCGAGTTATCCACGACATTGCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-646s21c1
Sequence:CCGGTCATCAACAAGTTCGTGAATACTCGAGTATTCACGAACTTGTTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-483s21c1
Sequence:CCGGCCCATCATTGGCCAGATTATCCTCGAGGATAATCTGGCCAATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-530s21c1
Sequence:CCGGGACCGCAGTCACAATTGAAACCTCGAGGTTTCAATTGTGACTGCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080574
BPIFA2 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family A, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000151615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-204s1c1
Sequence:CCGGGAGACAGTTGACAATACTCTTCTCGAGAAGAGTATTGTCAACTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080574.2-534s1c1
Sequence:CCGGGCAGTCACAATTGAAACTGATCTCGAGATCAGTTTCAATTGTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080574.2-132s1c1
Sequence:CCGGCTTCTTGACAATCTTGGCAATCTCGAGATTGCCAAGATTGTCAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-710s1c1
Sequence:CCGGGAAGGAGATATGTCCACTGATCTCGAGATCAGTGGACATATCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-777s1c1
Sequence:CCGGGTCGATAATCCTCAGCACAAACTCGAGTTTGTGCTGAGGATTATCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080574.2-776s1c1
Sequence:CCGGCGTCGATAATCCTCAGCACAACTCGAGTTGTGCTGAGGATTATCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-155s21c1
Sequence:CCGGCCTAAGCAATGTCGTGGATAACTCGAGTTATCCACGACATTGCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-646s21c1
Sequence:CCGGTCATCAACAAGTTCGTGAATACTCGAGTATTCACGAACTTGTTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-483s21c1
Sequence:CCGGCCCATCATTGGCCAGATTATCCTCGAGGATAATCTGGCCAATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080574.2-530s21c1
Sequence:CCGGGACCGCAGTCACAATTGAAACCTCGAGGTTTCAATTGTGACTGCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008953
BPIFA2 MISSION shRNA Bacterial Glycerol Stock
BPI fold containing family A, member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008953.2-820s1c1
Sequence:CCGGGATGGCATTTCCCTCTAGAAACTCGAGTTTCTAGAGGGAAATGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-259s21c1
Sequence:CCGGCAGCGGACCTTGGCAATTTAACTCGAGTTAAATTGCCAAGGTCCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008953.2-795s21c1
Sequence:CCGGTCTCCAGTGGTTTCATCTTACCTCGAGGTAAGATGAAACCACTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-556s21c1
Sequence:CCGGCCTTGTTGGGAAGACGATTACCTCGAGGTAATCGTCTTCCCAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008953.2-230s1c1
Sequence:CCGGCAAGAACAGCATTCTAGAAACCTCGAGGTTTCTAGAATGCTGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008953.2-445s1c1
Sequence:CCGGCTGTTTCCTTGGACCTCATAACTCGAGTTATGAGGTCCAAGGAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-424s21c1
Sequence:CCGGTTGGCAAGACGGTCGACATTTCTCGAGAAATGTCGACCGTCTTGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-518s21c1
Sequence:CCGGAGGCAAATGCTCCAGTAATACCTCGAGGTATTACTGGAGCATTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008953
BPIFA2 MISSION shRNA shRNA Plasmid DNA
BPI fold containing family A, member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008953.2-820s1c1
Sequence:CCGGGATGGCATTTCCCTCTAGAAACTCGAGTTTCTAGAGGGAAATGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-259s21c1
Sequence:CCGGCAGCGGACCTTGGCAATTTAACTCGAGTTAAATTGCCAAGGTCCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008953.2-795s21c1
Sequence:CCGGTCTCCAGTGGTTTCATCTTACCTCGAGGTAAGATGAAACCACTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-556s21c1
Sequence:CCGGCCTTGTTGGGAAGACGATTACCTCGAGGTAATCGTCTTCCCAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008953.2-230s1c1
Sequence:CCGGCAAGAACAGCATTCTAGAAACCTCGAGGTTTCTAGAATGCTGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008953.2-445s1c1
Sequence:CCGGCTGTTTCCTTGGACCTCATAACTCGAGTTATGAGGTCCAAGGAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-424s21c1
Sequence:CCGGTTGGCAAGACGGTCGACATTTCTCGAGAAATGTCGACCGTCTTGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-518s21c1
Sequence:CCGGAGGCAAATGCTCCAGTAATACCTCGAGGTATTACTGGAGCATTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008953
BPIFA2 MISSION shRNA Lentiviral Transduction Particles
BPI fold containing family A, member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008953.2-820s1c1
Sequence:CCGGGATGGCATTTCCCTCTAGAAACTCGAGTTTCTAGAGGGAAATGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-259s21c1
Sequence:CCGGCAGCGGACCTTGGCAATTTAACTCGAGTTAAATTGCCAAGGTCCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008953.2-795s21c1
Sequence:CCGGTCTCCAGTGGTTTCATCTTACCTCGAGGTAAGATGAAACCACTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-556s21c1
Sequence:CCGGCCTTGTTGGGAAGACGATTACCTCGAGGTAATCGTCTTCCCAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008953.2-230s1c1
Sequence:CCGGCAAGAACAGCATTCTAGAAACCTCGAGGTTTCTAGAATGCTGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008953.2-445s1c1
Sequence:CCGGCTGTTTCCTTGGACCTCATAACTCGAGTTATGAGGTCCAAGGAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-424s21c1
Sequence:CCGGTTGGCAAGACGGTCGACATTTCTCGAGAAATGTCGACCGTCTTGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008953.2-518s21c1
Sequence:CCGGAGGCAAATGCTCCAGTAATACCTCGAGGTATTACTGGAGCATTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)