BRD4

bromodomain containing 4

218 Gene Product Result for

Synonyms: CAP HUNK1 HUNKI MCAP

Species: Human BRD4(23476), Mouse Brd4(57261), Rat Brd4(362844), Zebrafish brd4(570531), cow BRD4(614048), Horse BRD4(100062072), domestic cat BRD4(101100035), dog BRD4(484869), chicken BRD4(430442), Thale Cress BRD4(2745841), naked mole-rat Brd4(101723132), domestic guinea pig Brd4(100717142), sheep BRD4(101123297), Domestic Rabbit BRD4(100352214)

UniProtKB ID: O60885, O60433, Q4G0X8, Q86YS8, Q96PD3

Gene ID:

Human(23476) Summary: The protein encoded by this gene is homologous to the murine protein MCAP, which associates with chromosomes during mitosis, and to the human RING3 protein, a serine/threonine kinase. Each of these proteins contains two bromodomains, a conserved sequence motif which may be involved in chromatin targeting. This gene has been implicated as the chromosome 19 target of translocation t(15;19)(q13;p13.1), which defines an upper respiratory tract carcinoma in young people. Two alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]

Mouse(57261) bromodomain containing 4

Rat(362844) bromodomain containing 4

Zebrafish(570531) bromodomain containing 4

cow(614048) bromodomain containing 4

Horse(100062072) bromodomain containing 4

domestic cat(101100035) bromodomain containing 4

dog(484869) bromodomain containing 4

chicken(430442) bromodomain containing 4

Thale Cress(2745841) bromodomain 4

naked mole-rat(101723132) bromodomain containing 4

domestic guinea pig(100717142) bromodomain containing 4

sheep(101123297) bromodomain containing 4

Domestic Rabbit(100352214) bromodomain containing 4

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB2108521	Anti-BRD4 affinity isolated antibody	bovine, rabbit, dog, rat, horse, human, mouse, guinea pig	ChIP, immunofluorescence, western blot	pricing

HPA015055	Anti-BRD4 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry	pricing

AV39076	Anti-BRD4 antibody produced in rabbit affinity isolated antibody	horse, rabbit, rat, guinea pig, human, mouse, bovine, canine	western blot	pricing

HPA061646	Anti-BRD4 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry	pricing

SAB1410426	Anti-BRD4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

AMAB90843	Monoclonal Anti-BRD4 antibody produced in mouse Prestige Antibodies^® Powered by Atlas Antibodies, clone CL1118, purified immunoglobulin, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

AMAB90841	Monoclonal Anti-BRD4 antibody produced in mouse Prestige Antibodies^® Powered by Atlas Antibodies, clone CL1115, purified immunoglobulin, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

PLA0227	Rabbit anti-BRD4 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc.	mouse, human	immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN27701	CompoZr^® Knockout ZFN Kit Mouse Brd4 (NM_198094.2)	pricing

CKOZFN4050	CompoZr^® Knockout ZFN Kit Human BRD4 (NM_014299)	pricing

CKOZFN51243	CompoZr^® Knockout ZFN Kit Rat Brd4 (NM_001100903)	pricing

CKOZFND27701	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Brd4 (NM_198094.2)	pricing

CKOZFND4050	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human BRD4 (NM_014299)	pricing

CKOZFND51243	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Brd4 (NM_001100903)	pricing

Proteins

Product #	Description	Species	Add to Cart

SRP0460	BRD4 (342-460) GST tag human recombinant, expressed in E. coli, ≥75% (SDS-PAGE)	human	pricing

SRP0462	BRD4 (342-460) His tag human recombinant, expressed in E. coli, ≥90% (SDS-PAGE)	human	pricing

SRP0459	BRD4 (49-170) GST tag human recombinant, expressed in E. coli, ≥82% (SDS-PAGE)	human	pricing

SRP0461	BRD4 (49-170) His tag human recombinant, expressed in E. coli, ≥90% (SDS-PAGE)	human	pricing

SRP0463	BRD4, BD1, BD2 (49-460) GST tag human recombinant, expressed in E. coli, ≥80% (SDS-PAGE)	human	pricing

SRP0464	BRD4, BD1, BD2 (49-460) His tag human recombinant, expressed in E. coli, ≥75% (SDS-PAGE)	human	pricing

APREST73498	PrEST Antigen BRD4 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

APREST87931	PrEST Antigen BRD4 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST21515	SILu^™PrEST BRD4 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_058243	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_058243	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_058243	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_198094	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_198094	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_198094	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU076751	MISSION^® esiRNA esiRNA human BRD4 (esiRNA1)	human	pricing

EMU051511	MISSION^® esiRNA esiRNA targeting mouse Brd4 (esiRNA1)	mouse	pricing

siRNA Nano Scale

Product #	Description	Species	Add to Cart

SIHK0192	MISSION^® siRNA Human Kinase BRD4 (siRNA1), Nano Scale 0.25 nmol	human	pricing

SIHK0193	MISSION^® siRNA Human Kinase BRD4 (siRNA2), Nano Scale 0.25 nmol	human	pricing

SIHK0194	MISSION^® siRNA Human Kinase BRD4 (siRNA3), Nano Scale 0.25 nmol	human	pricing

Related Products

Product #	Description	Add to Cart

ABE1391	Anti-Brd4 Antibody This Anti-Brd4 Antibody is validated for use in Western Blotting and Chromatin Immunoprecipitation (ChIP) and Immunocytochemistry for the detection of Brd4.	pricing

MABE918	Anti-Brd4 Antibody, clone 1F11 Anti-Brd4, clone 1F11 is an antibody against Brd4 for use in WB, ChIP.	pricing

ABE1451	Anti-phospho BRD4 (Ser492) Detect BRD4 Serine 492 phosphorylation using this rabbit polyclonal Anti-phospho BRD4 (Ser492), Cat. No. ABE1451, validated for use in Immunocytochemistry, Dot Blot and Western Blotting.	pricing

ABE1453	Anti-phospho Brd4 (Ser492/Ser494) Anti-phospho Brd4 (Ser492/Ser494), Cat. No. ABE1453, is a highly specific rabbit polyclonal antibody that targets Bromodomain-containing protein 4 and has been tested in Dot Blot, Immunocytochemistry, Immunohistochemistry, and Western Blotting.	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_014299	Rosetta Predictions	human	pricing
NM_058243	Rosetta Predictions	human	pricing
XM_001065925	Rosetta Predictions	rat	pricing
XM_001066148	Rosetta Predictions	rat	pricing
XM_001077931	Rosetta Predictions	rat	pricing
XM_343175	Rosetta Predictions	rat	pricing
NM_020508	Rosetta Predictions	mouse	pricing
NM_198094	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_014299	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00037409 predicted	1448
2	SASI_Hs01_00037410 predicted	497
3	SASI_Hs01_00037411 predicted	569
4	SASI_Hs01_00037413 predicted	502
5	SASI_Hs02_00345387 predicted	615
6	SASI_Hs01_00037414 predicted	281
7	SASI_Hs01_00037415 predicted	528
8	SASI_Hs01_00037416 predicted	1560
9	SASI_Hs01_00037417 predicted	1480
10	SASI_Hs01_00037418 predicted	1467
11	SASI_Hs01_00037412 predicted	651

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_058243	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00126965 predicted	1446
2	SASI_Hs01_00126966 predicted	500
3	SASI_Hs01_00126967 predicted	576
4	SASI_Hs01_00126969 predicted	495
5	SASI_Hs02_00362148 predicted	616
6	SASI_Hs01_00126970 predicted	280
7	SASI_Hs01_00126971 predicted	524
8	SASI_Hs01_00126972 predicted	1558
9	SASI_Hs01_00126973 predicted	1483
10	SASI_Hs01_00126974 predicted	1471
11	SASI_Hs01_00126968 predicted	649

siRNA

PRODUCT #	siRNA Type ?	SPECIES
XM_001065925	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00315745 predicted	1631
2	SASI_Rn02_00315746 predicted	2498
3	SASI_Rn02_00315747 predicted	1627
4	SASI_Rn02_00315748 predicted	2374
5	SASI_Rn02_00315749 predicted	1681
6	SASI_Rn02_00315750 predicted	1032
7	SASI_Rn02_00315751 predicted	3927
8	SASI_Rn02_00315752 predicted	1802
9	SASI_Rn02_00315753 predicted	2429
10	SASI_Rn02_00315754 predicted	1334

siRNA

PRODUCT #	siRNA Type ?	SPECIES
XM_001066148	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00316424 predicted	723
2	SASI_Rn02_00316425 predicted	507
3	SASI_Rn02_00316426 predicted	495
4	SASI_Rn02_00316427 predicted	720
5	SASI_Rn02_00316428 predicted	623
6	SASI_Rn02_00316429 predicted	1341
7	SASI_Rn02_00316430 predicted	538
8	SASI_Rn02_00316431 predicted	200
9	SASI_Rn02_00316432 predicted	259
10	SASI_Rn02_00316433 predicted	1397

siRNA

PRODUCT #	siRNA Type ?	SPECIES
XM_001077931	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00359060 predicted	378
2	SASI_Rn02_00359061 predicted	1297
3	SASI_Rn02_00359062 predicted	470
4	SASI_Rn02_00359063 predicted	455
5	SASI_Rn02_00359064 predicted	1292
6	SASI_Rn02_00359065 predicted	501
7	SASI_Rn02_00359066 predicted	2044
8	SASI_Rn02_00359067 predicted	1350
9	SASI_Rn02_00359068 predicted	696
10	SASI_Rn02_00359069 predicted	2096

siRNA

PRODUCT #	siRNA Type ?	SPECIES
XM_343175	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00395423 predicted	719
2	SASI_Rn02_00395424 predicted	508
3	SASI_Rn02_00395425 predicted	495
4	SASI_Rn02_00395426 predicted	713
5	SASI_Rn02_00395427 predicted	626
6	SASI_Rn02_00395428 predicted	1344
7	SASI_Rn02_00395429 predicted	544
8	SASI_Rn02_00395430 predicted	203
9	SASI_Rn02_00395431 predicted	250
10	SASI_Rn02_00395432 predicted	1396

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_020508	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00116323 predicted	523
2	SASI_Mm01_00116324 predicted	413
3	SASI_Mm02_00325562 predicted	1434
4	SASI_Mm02_00325563 predicted	1466
5	SASI_Mm01_00116326 predicted	298
6	SASI_Mm01_00116327 predicted	1454
7	SASI_Mm01_00116328 predicted	1446
8	SASI_Mm01_00116329 predicted	299
9	SASI_Mm01_00116330 predicted	1506
10	SASI_Mm02_00325564 predicted	524
11	SASI_Mm01_00116325 predicted	1221
12	SASI_Mm01_00116331 predicted	1604
13	SASI_Mm01_00116332 predicted	1148

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_198094	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00097957 predicted	519
2	SASI_Mm01_00097958 predicted	412
3	SASI_Mm02_00350816 predicted	1438
4	SASI_Mm02_00350817 predicted	1468
5	SASI_Mm01_00097960 predicted	294
6	SASI_Mm01_00097961 predicted	1452
7	SASI_Mm01_00097962 predicted	1448
8	SASI_Mm01_00097963 predicted	300
9	SASI_Mm01_00097964 predicted	1504
10	SASI_Mm02_00350818 predicted	518
11	SASI_Mm01_00097959 predicted	1219
12	SASI_Mm01_00097965 predicted	1607
13	SASI_Mm01_00097966 predicted	1151

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_058243 VALIDATED	BRD4 MISSION shRNA Bacterial Glycerol Stock bromodomain containing 4	Human

16 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000199674
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-1298s1c1
	Sequence:CCGGGCATCCTCAAGGAGATGTTTGCTCGAGCAAACATCTCCTTGAGGATGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199459
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: A549
	TRC Version: 1	Clone ID:NM_058243.1-2046s1c1
	Sequence:CCGGGCCTATGTCCTATGAGGAGAACTCGAGTTCTCCTCATAGGACATAGGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196576
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.74	Cell Line: A549
	TRC Version: 1	Clone ID:NM_058243.1-4626s1c1
	Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195245
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-532s1c1
	Sequence:CCGGCCTATGGATATGGGAACAATACTCGAGTATTGTTCCCATATCCATAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000382028
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-497s21c1
	Sequence:GTACCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021424
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_058243.1-4624s1c1
	Sequence:CCGGCCGCCAAATGTCTACACAGTACTCGAGTACTGTGTAGACATTTGGCGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021426
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-1485s1c1
	Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000318773
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-1707s21c1
	Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380426
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-4263s21c1
	Sequence:GTACCGGGAATTTCCAGAGTGATCTATTCTCGAGAATAGATCACTCTGGAAATTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380416
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-1420s21c1
	Sequence:GTACCGGATGAGCACAATCAAGTCTAAACTCGAGTTTAGACTTGATTGTGCTCATTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000349580
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_058243.2-4626s21c1
	Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195294
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-4270s1c1
	Sequence:CCGGCAGAGTGATCTATTGTCAATACTCGAGTATTGACAATAGATCACTCTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199427
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 1	Clone ID:NM_058243.1-1707s1c1
	Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199972
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_058243.1-5005s1c1
	Sequence:CCGGCCAACCAAAGTCAGTTCCTTCCTCGAGGAAGGAACTGACTTTGGTTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000318771
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-646s21c1
	Sequence:CCGGCCTGGAGATGACATAGTCTTACTCGAGTAAGACTATGTCATCTCCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000318836
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_058243.2-1485s21c1
	Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_058243 VALIDATED	BRD4 MISSION shRNA shRNA Plasmid DNA bromodomain containing 4	Human

16 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000199674
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-1298s1c1
	Sequence:CCGGGCATCCTCAAGGAGATGTTTGCTCGAGCAAACATCTCCTTGAGGATGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199459
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: A549
	TRC Version: 1	Clone ID:NM_058243.1-2046s1c1
	Sequence:CCGGGCCTATGTCCTATGAGGAGAACTCGAGTTCTCCTCATAGGACATAGGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196576
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.74	Cell Line: A549
	TRC Version: 1	Clone ID:NM_058243.1-4626s1c1
	Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195245
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-532s1c1
	Sequence:CCGGCCTATGGATATGGGAACAATACTCGAGTATTGTTCCCATATCCATAGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000382028
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-497s21c1
	Sequence:GTACCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021424
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_058243.1-4624s1c1
	Sequence:CCGGCCGCCAAATGTCTACACAGTACTCGAGTACTGTGTAGACATTTGGCGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021426
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-1485s1c1
	Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000318773
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-1707s21c1
	Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380426
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-4263s21c1
	Sequence:GTACCGGGAATTTCCAGAGTGATCTATTCTCGAGAATAGATCACTCTGGAAATTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380416
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-1420s21c1
	Sequence:GTACCGGATGAGCACAATCAAGTCTAAACTCGAGTTTAGACTTGATTGTGCTCATTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000349580
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_058243.2-4626s21c1
	Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195294
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-4270s1c1
	Sequence:CCGGCAGAGTGATCTATTGTCAATACTCGAGTATTGACAATAGATCACTCTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199427
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 1	Clone ID:NM_058243.1-1707s1c1
	Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199972
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_058243.1-5005s1c1
	Sequence:CCGGCCAACCAAAGTCAGTTCCTTCCTCGAGGAAGGAACTGACTTTGGTTGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000318771
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-646s21c1
	Sequence:CCGGCCTGGAGATGACATAGTCTTACTCGAGTAAGACTATGTCATCTCCAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000318836
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_058243.2-1485s21c1
	Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_058243 VALIDATED	BRD4 MISSION shRNA Lentiviral Transduction Particles bromodomain containing 4	Human

16 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000199674
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-1298s1c1
	Sequence:CCGGGCATCCTCAAGGAGATGTTTGCTCGAGCAAACATCTCCTTGAGGATGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199459
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: A549
	TRC Version: 1	Clone ID:NM_058243.1-2046s1c1
	Sequence:CCGGGCCTATGTCCTATGAGGAGAACTCGAGTTCTCCTCATAGGACATAGGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196576
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.74	Cell Line: A549
	TRC Version: 1	Clone ID:NM_058243.1-4626s1c1
	Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195245
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-532s1c1
	Sequence:CCGGCCTATGGATATGGGAACAATACTCGAGTATTGTTCCCATATCCATAGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000382028
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-497s21c1
	Sequence:GTACCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021424
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_058243.1-4624s1c1
	Sequence:CCGGCCGCCAAATGTCTACACAGTACTCGAGTACTGTGTAGACATTTGGCGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021426
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-1485s1c1
	Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000318773
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-1707s21c1
	Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380426
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-4263s21c1
	Sequence:GTACCGGGAATTTCCAGAGTGATCTATTCTCGAGAATAGATCACTCTGGAAATTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380416
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-1420s21c1
	Sequence:GTACCGGATGAGCACAATCAAGTCTAAACTCGAGTTTAGACTTGATTGTGCTCATTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000349580
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_058243.2-4626s21c1
	Sequence:CCGGGCCAAATGTCTACACAGTATACTCGAGTATACTGTGTAGACATTTGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195294
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_058243.1-4270s1c1
	Sequence:CCGGCAGAGTGATCTATTGTCAATACTCGAGTATTGACAATAGATCACTCTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199427
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 1	Clone ID:NM_058243.1-1707s1c1
	Sequence:CCGGCAGTGACAGTTCGACTGATGACTCGAGTCATCAGTCGAACTGTCACTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199972
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_058243.1-5005s1c1
	Sequence:CCGGCCAACCAAAGTCAGTTCCTTCCTCGAGGAAGGAACTGACTTTGGTTGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000318771
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 2	Clone ID:NM_058243.2-646s21c1
	Sequence:CCGGCCTGGAGATGACATAGTCTTACTCGAGTAAGACTATGTCATCTCCAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000318836
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_058243.2-1485s21c1
	Sequence:CCGGCGTCCGATTGATGTTCTCCAACTCGAGTTGGAGAACATCAATCGGACGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_198094 VALIDATED	BRD4 MISSION shRNA Bacterial Glycerol Stock bromodomain containing 4	Mouse

9 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000088479
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_198094.1-520s1c1
	Sequence:CCGGCCTCCCTGATTACTATAAGATCTCGAGATCTTATAGTAATCAGGGAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088478
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.61	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-2511s1c1
	Sequence:CCGGGACTCCATCAAGTTATGGAATCTCGAGATTCCATAACTTGATGGAGTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088481
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-1586s1c1
	Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088480
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-2089s1c1
	Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088482
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-2224s1c1
	Sequence:CCGGGCCATCTACACTACGAGAGTTCTCGAGAACTCTCGTAGTGTAGATGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000349782
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_198094.2-2430s21c1
	Sequence:CCGGATTGGACACGGACTCTTAATACTCGAGTATTAAGAGTCCGTGTCCAATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311977
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_198094.2-2103s21c1
	Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311976
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_198094.2-1600s21c1
	Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000349783
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_198094.2-530s21c1
	Sequence:CCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_198094 VALIDATED	BRD4 MISSION shRNA shRNA Plasmid DNA bromodomain containing 4	Mouse

9 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000088479
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_198094.1-520s1c1
	Sequence:CCGGCCTCCCTGATTACTATAAGATCTCGAGATCTTATAGTAATCAGGGAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088478
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.61	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-2511s1c1
	Sequence:CCGGGACTCCATCAAGTTATGGAATCTCGAGATTCCATAACTTGATGGAGTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088481
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-1586s1c1
	Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088480
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-2089s1c1
	Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088482
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-2224s1c1
	Sequence:CCGGGCCATCTACACTACGAGAGTTCTCGAGAACTCTCGTAGTGTAGATGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000349782
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_198094.2-2430s21c1
	Sequence:CCGGATTGGACACGGACTCTTAATACTCGAGTATTAAGAGTCCGTGTCCAATTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311977
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_198094.2-2103s21c1
	Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311976
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_198094.2-1600s21c1
	Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000349783
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_198094.2-530s21c1
	Sequence:CCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_198094 VALIDATED	BRD4 MISSION shRNA Lentiviral Transduction Particles bromodomain containing 4	Mouse

9 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000088479
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_198094.1-520s1c1
	Sequence:CCGGCCTCCCTGATTACTATAAGATCTCGAGATCTTATAGTAATCAGGGAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088478
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.61	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-2511s1c1
	Sequence:CCGGGACTCCATCAAGTTATGGAATCTCGAGATTCCATAACTTGATGGAGTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088481
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-1586s1c1
	Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088480
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-2089s1c1
	Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000088482
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_198094.1-2224s1c1
	Sequence:CCGGGCCATCTACACTACGAGAGTTCTCGAGAACTCTCGTAGTGTAGATGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000349782
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_198094.2-2430s21c1
	Sequence:CCGGATTGGACACGGACTCTTAATACTCGAGTATTAAGAGTCCGTGTCCAATTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311977
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_198094.2-2103s21c1
	Sequence:CCGGGCGGCAGCTAAGTCTAGATATCTCGAGATATCTAGACTTAGCTGCCGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311976
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_198094.2-1600s21c1
	Sequence:CCGGGATGTGTTTGAAATGCGCTTTCTCGAGAAAGCGCATTTCAAACACATCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000349783
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_198094.2-530s21c1
	Sequence:CCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart