EMAIL THIS PAGE TO A FRIEND

BRI3BP

BRI3 binding protein

46 Gene Product Result for
Synonyms: BNAS1 HCCR-1 HCCR-2 HCCRBP-1 KG19
UniProtKB ID: Q8WY22, Q8WY23
Gene ID:
Mouse(76809) Bri3 binding protein
Rat(498176) Bri3 binding protein
sheep(101120525) BRI3 binding protein
domestic guinea pig(100718535) BRI3 binding protein
naked mole-rat(101700376) BRI3 binding protein
Zebrafish(327046) bri3 binding protein
chicken(416812) BRI3 binding protein
cow(538558) BRI3 binding protein
domestic cat(101083212) BRI3 binding protein
dog(100688197) BRI3 binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080626 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080626 Rosetta Predictions human pricing
NM_001017487 Rosetta Predictions rat pricing
NM_029752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033099 predicted 997
2 SASI_Hs01_00033100 predicted 700
3 SASI_Hs02_00362371 predicted 1012
4 SASI_Hs01_00033101 predicted 744
5 SASI_Hs01_00033102 predicted 852
6 SASI_Hs01_00033103 predicted 834
7 SASI_Hs01_00033104 predicted 742
8 SASI_Hs01_00033105 predicted 577
9 SASI_Hs01_00033106 predicted 593
10 SASI_Hs01_00033107 predicted 637
11 SASI_Hs01_00033108 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068613 predicted 725
2 SASI_Rn01_00068614 predicted 286
3 SASI_Rn01_00068615 predicted 430
4 SASI_Rn01_00068616 predicted 596
5 SASI_Rn01_00068617 predicted 746
6 SASI_Rn01_00068618 predicted 262
7 SASI_Rn01_00068619 predicted 731
8 SASI_Rn01_00068620 predicted 279
9 SASI_Rn01_00068621 predicted 341
10 SASI_Rn01_00068622 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335865 predicted 867
2 SASI_Mm02_00335866 predicted 1105
3 SASI_Mm02_00335867 predicted 800
4 SASI_Mm02_00335868 predicted 508
5 SASI_Mm02_00335869 predicted 811
6 SASI_Mm02_00335870 predicted 594
7 SASI_Mm02_00335871 predicted 411
8 SASI_Mm02_00335872 predicted 1101
9 SASI_Mm02_00335873 predicted 359
10 SASI_Mm02_00335874 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029752
VALIDATED
BRI3BP MISSION shRNA Bacterial Glycerol Stock
BRI3 binding protein
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029752.2-837s21c1
Sequence:CCGGACCGCTCCAAGGACAAGTGAACTCGAGTTCACTTGTCCTTGGAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029752.2-6430s21c1
Sequence:CCGGTGTGAACATTGCGGCTTAATACTCGAGTATTAAGCCGCAATGTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029752.2-619s21c1
Sequence:CCGGCTGCGTGTATATCCTACATAACTCGAGTTATGTAGGATATACACGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029752.2-783s21c1
Sequence:CCGGAGAACCAGGTGAGGTTGCTTACTCGAGTAAGCAACCTCACCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029752.2-367s21c1
Sequence:CCGGCATGTTCTTAGAGACGTTATGCTCGAGCATAACGTCTCTAAGAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029752.1-312s1c1
Sequence:CCGGGTTCTTAGAGACGTTATGGAACTCGAGTTCCATAACGTCTCTAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029752
VALIDATED
BRI3BP MISSION shRNA shRNA Plasmid DNA
BRI3 binding protein
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029752.2-837s21c1
Sequence:CCGGACCGCTCCAAGGACAAGTGAACTCGAGTTCACTTGTCCTTGGAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029752.2-6430s21c1
Sequence:CCGGTGTGAACATTGCGGCTTAATACTCGAGTATTAAGCCGCAATGTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029752.2-619s21c1
Sequence:CCGGCTGCGTGTATATCCTACATAACTCGAGTTATGTAGGATATACACGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029752.2-783s21c1
Sequence:CCGGAGAACCAGGTGAGGTTGCTTACTCGAGTAAGCAACCTCACCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029752.2-367s21c1
Sequence:CCGGCATGTTCTTAGAGACGTTATGCTCGAGCATAACGTCTCTAAGAACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029752.1-312s1c1
Sequence:CCGGGTTCTTAGAGACGTTATGGAACTCGAGTTCCATAACGTCTCTAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029752
VALIDATED
BRI3BP MISSION shRNA Lentiviral Transduction Particles
BRI3 binding protein
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029752.2-837s21c1
Sequence:CCGGACCGCTCCAAGGACAAGTGAACTCGAGTTCACTTGTCCTTGGAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029752.2-6430s21c1
Sequence:CCGGTGTGAACATTGCGGCTTAATACTCGAGTATTAAGCCGCAATGTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029752.2-619s21c1
Sequence:CCGGCTGCGTGTATATCCTACATAACTCGAGTTATGTAGGATATACACGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029752.2-783s21c1
Sequence:CCGGAGAACCAGGTGAGGTTGCTTACTCGAGTAAGCAACCTCACCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029752.2-367s21c1
Sequence:CCGGCATGTTCTTAGAGACGTTATGCTCGAGCATAACGTCTCTAAGAACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029752.1-312s1c1
Sequence:CCGGGTTCTTAGAGACGTTATGGAACTCGAGTTCCATAACGTCTCTAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080626
VALIDATED
BRI3BP MISSION shRNA Bacterial Glycerol Stock
BRI3 binding protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-640s21c1
Sequence:CCGGTTTCCATGTCCTGCGTGTACACTCGAGTGTACACGCAGGACATGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080626.5-380s21c1
Sequence:CCGGATTTGTGCTGGGAGTGGATATCTCGAGATATCCACTCCCAGCACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-1015s21c1
Sequence:CCGGTGGCGCTGTGTAGGGCTATTTCTCGAGAAATAGCCCTACACAGCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-839s21c1
Sequence:CCGGACTGCTCAACATCCGTCTCAACTCGAGTTGAGACGGATGTTGAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-461s21c1
Sequence:CCGGCTCCAACCTGTCCCAGTATTTCTCGAGAAATACTGGGACAGGTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080626.5-396s1c1
Sequence:CCGGGATATGTTCGTGGAGACACTGCTCGAGCAGTGTCTCCACGAACATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080626.5-653s1c1
Sequence:CCGGCGTGTACATCCTGCACAAGTACTCGAGTACTTGTGCAGGATGTACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080626
VALIDATED
BRI3BP MISSION shRNA shRNA Plasmid DNA
BRI3 binding protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-640s21c1
Sequence:CCGGTTTCCATGTCCTGCGTGTACACTCGAGTGTACACGCAGGACATGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080626.5-380s21c1
Sequence:CCGGATTTGTGCTGGGAGTGGATATCTCGAGATATCCACTCCCAGCACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-1015s21c1
Sequence:CCGGTGGCGCTGTGTAGGGCTATTTCTCGAGAAATAGCCCTACACAGCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-839s21c1
Sequence:CCGGACTGCTCAACATCCGTCTCAACTCGAGTTGAGACGGATGTTGAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-461s21c1
Sequence:CCGGCTCCAACCTGTCCCAGTATTTCTCGAGAAATACTGGGACAGGTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080626.5-396s1c1
Sequence:CCGGGATATGTTCGTGGAGACACTGCTCGAGCAGTGTCTCCACGAACATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080626.5-653s1c1
Sequence:CCGGCGTGTACATCCTGCACAAGTACTCGAGTACTTGTGCAGGATGTACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080626
VALIDATED
BRI3BP MISSION shRNA Lentiviral Transduction Particles
BRI3 binding protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-640s21c1
Sequence:CCGGTTTCCATGTCCTGCGTGTACACTCGAGTGTACACGCAGGACATGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080626.5-380s21c1
Sequence:CCGGATTTGTGCTGGGAGTGGATATCTCGAGATATCCACTCCCAGCACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-1015s21c1
Sequence:CCGGTGGCGCTGTGTAGGGCTATTTCTCGAGAAATAGCCCTACACAGCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-839s21c1
Sequence:CCGGACTGCTCAACATCCGTCTCAACTCGAGTTGAGACGGATGTTGAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_080626.5-461s21c1
Sequence:CCGGCTCCAACCTGTCCCAGTATTTCTCGAGAAATACTGGGACAGGTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080626.5-396s1c1
Sequence:CCGGGATATGTTCGTGGAGACACTGCTCGAGCAGTGTCTCCACGAACATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080626.5-653s1c1
Sequence:CCGGCGTGTACATCCTGCACAAGTACTCGAGTACTTGTGCAGGATGTACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)