EMAIL THIS PAGE TO A FRIEND

BTBD8

BTB (POZ) domain containing 8

35 Gene Product Result for
UniProtKB ID: Q5XKL5, Q6V9S5
Gene ID:
Mouse(100503185) BTB (POZ) domain containing 8
Rat(690003) BTB (POZ) domain containing 8
cow(520456) BTB (POZ) domain containing 8
Horse(100060100) BTB (POZ) domain containing 8
dog(612373) BTB (POZ) domain containing 8
domestic cat(101085817) BTB (POZ) domain containing 8
domestic guinea pig(100720203) BTB (POZ) domain containing 8
sheep(101102944) BTB (POZ) domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183242 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183242 Rosetta Predictions human pricing
XM_001072880 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020391 predicted 1181
2 SASI_Hs01_00020392 predicted 1058
3 SASI_Hs01_00020394 predicted 412
4 SASI_Hs01_00020395 predicted 1174
5 SASI_Hs01_00020396 predicted 640
6 SASI_Hs02_00371251 predicted 735
7 SASI_Hs01_00020399 predicted 967
8 SASI_Hs01_00020400 predicted 987
9 SASI_Hs02_00371252 predicted 1068
10 SASI_Hs02_00371253 predicted 1114
11 SASI_Hs01_00020393 predicted 1079
12 SASI_Hs01_00020397 predicted 660
13 SASI_Hs01_00020398 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340763 predicted 1069
2 SASI_Rn02_00340764 predicted 1037
3 SASI_Rn02_00340765 predicted 539
4 SASI_Rn02_00340766 predicted 570
5 SASI_Rn02_00340767 predicted 1156
6 SASI_Rn02_00340768 predicted 597
7 SASI_Rn02_00340769 predicted 430
8 SASI_Rn02_00340770 predicted 1027
9 SASI_Rn02_00340771 predicted 494
10 SASI_Rn02_00340772 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183242
BTBD8 MISSION shRNA Bacterial Glycerol Stock
BTB (POZ) domain containing 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183242.3-1222s21c1
Sequence:CCGGATACTAGAATGCCTGATTATTCTCGAGAATAATCAGGCATTCTAGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183242.3-1094s21c1
Sequence:CCGGATGTTGGTCAGATACTCAATACTCGAGTATTGAGTATCTGACCAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-985s1c1
Sequence:CCGGCTTCAAGGTATAAGCCATGTACTCGAGTACATGGCTTATACCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183242.1-473s1c1
Sequence:CCGGCAAGAGTTCCTGACTTCTATTCTCGAGAATAGAAGTCAGGAACTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-805s1c1
Sequence:CCGGGCATCTGAATTAGGAGAAGATCTCGAGATCTTCTCCTAATTCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-715s1c1
Sequence:CCGGGATTGTTCTCTTCAGAAGCATCTCGAGATGCTTCTGAAGAGAACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-521s1c1
Sequence:CCGGGTTTAACAAATCAGGAGCCTACTCGAGTAGGCTCCTGATTTGTTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-1090s1c1
Sequence:CCGGGCTGATATGTATGGACTAGAACTCGAGTTCTAGTCCATACATATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183242
BTBD8 MISSION shRNA shRNA Plasmid DNA
BTB (POZ) domain containing 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183242.3-1222s21c1
Sequence:CCGGATACTAGAATGCCTGATTATTCTCGAGAATAATCAGGCATTCTAGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183242.3-1094s21c1
Sequence:CCGGATGTTGGTCAGATACTCAATACTCGAGTATTGAGTATCTGACCAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-985s1c1
Sequence:CCGGCTTCAAGGTATAAGCCATGTACTCGAGTACATGGCTTATACCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183242.1-473s1c1
Sequence:CCGGCAAGAGTTCCTGACTTCTATTCTCGAGAATAGAAGTCAGGAACTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-805s1c1
Sequence:CCGGGCATCTGAATTAGGAGAAGATCTCGAGATCTTCTCCTAATTCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-715s1c1
Sequence:CCGGGATTGTTCTCTTCAGAAGCATCTCGAGATGCTTCTGAAGAGAACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-521s1c1
Sequence:CCGGGTTTAACAAATCAGGAGCCTACTCGAGTAGGCTCCTGATTTGTTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-1090s1c1
Sequence:CCGGGCTGATATGTATGGACTAGAACTCGAGTTCTAGTCCATACATATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183242
BTBD8 MISSION shRNA Lentiviral Transduction Particles
BTB (POZ) domain containing 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183242.3-1222s21c1
Sequence:CCGGATACTAGAATGCCTGATTATTCTCGAGAATAATCAGGCATTCTAGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183242.3-1094s21c1
Sequence:CCGGATGTTGGTCAGATACTCAATACTCGAGTATTGAGTATCTGACCAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-985s1c1
Sequence:CCGGCTTCAAGGTATAAGCCATGTACTCGAGTACATGGCTTATACCTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183242.1-473s1c1
Sequence:CCGGCAAGAGTTCCTGACTTCTATTCTCGAGAATAGAAGTCAGGAACTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-805s1c1
Sequence:CCGGGCATCTGAATTAGGAGAAGATCTCGAGATCTTCTCCTAATTCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-715s1c1
Sequence:CCGGGATTGTTCTCTTCAGAAGCATCTCGAGATGCTTCTGAAGAGAACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-521s1c1
Sequence:CCGGGTTTAACAAATCAGGAGCCTACTCGAGTAGGCTCCTGATTTGTTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183242.1-1090s1c1
Sequence:CCGGGCTGATATGTATGGACTAGAACTCGAGTTCTAGTCCATACATATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)