EMAIL THIS PAGE TO A FRIEND

BYSL

bystin-like

59 Gene Product Result for
Synonyms: BYSTIN
UniProtKB ID: Q13895, Q6P5W4, Q86W44, Q96IP8
Gene ID:
Human(705) Summary: Bystin is expressed as a 2-kb major transcript and a 3.6-kb minor transcript in SNG-M cells and in human trophoblastic teratocarcinoma HT-H cells. Protein binding assays determined that bystin binds directly to trophinin and tastin, and that binding is enhanced when cytokeratins 8 and 18 are present. Immunocytochemistry of HT-H cells showed that bystin colocalizes with trophinin, tastin, and the cytokeratins, suggesting that these molecules form a complex in trophectoderm cells at the time of implantation. Using immunohistochemistry it was determined that trophinin and bystin are found in the placenta from the sixth week of pregnancy. Both proteins were localized in the cytoplasm of the syncytiotrophoblast in the chorionic villi and in endometrial decidual cells at the uteroplacental interface. After week 10, the levels of trophinin, tastin, and bystin decreased and then disappeared from placental villi. [provided by RefSeq, Jul 2008]
Mouse(53414) bystin-like
Rat(359727) bystin-like
Zebrafish(394081) bystin-like
cow(514128) bystin-like
Horse(100066546) bystin-like
dog(474900) bystin-like
chicken(419927) bystin-like
sheep(101107825) bystin-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004053 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004053 Rosetta Predictions human pricing
NM_182674 Rosetta Predictions rat pricing
NM_016859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173196 predicted 723
2 SASI_Hs01_00173197 predicted 1566
3 SASI_Hs01_00173198 predicted 909
4 SASI_Hs01_00173199 predicted 1517
5 SASI_Hs01_00173200 predicted 972
6 SASI_Hs01_00173201 predicted 1104
7 SASI_Hs01_00173203 predicted 1726
8 SASI_Hs01_00173204 predicted 1198
9 SASI_Hs01_00173205 predicted 1578
10 SASI_Hs02_00336825 predicted 975
11 SASI_Hs01_00173202 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269825 predicted 691
2 SASI_Rn02_00269826 predicted 288
3 SASI_Rn01_00095801 predicted 561
4 SASI_Rn02_00269827 predicted 869
5 SASI_Rn01_00095803 predicted 620
6 SASI_Rn01_00095804 predicted 945
7 SASI_Rn02_00269828 predicted 217
8 SASI_Rn01_00095807 predicted 1436
9 SASI_Rn01_00095808 predicted 1249
10 SASI_Rn02_00269829 predicted 281
11 SASI_Rn01_00095802 predicted 864
12 SASI_Rn01_00095805 predicted 413
13 SASI_Rn01_00095806 predicted 680
14 SASI_Rn01_00095809 predicted 926
15 SASI_Rn01_00095810 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323641 predicted 1459
2 SASI_Mm02_00323642 predicted 815
3 SASI_Mm02_00323643 predicted 1819
4 SASI_Mm02_00323644 predicted 1122
5 SASI_Mm02_00323645 predicted 1116
6 SASI_Mm02_00323646 predicted 1677
7 SASI_Mm02_00323647 predicted 1093
8 SASI_Mm02_00323648 predicted 1404
9 SASI_Mm02_00323649 predicted 1615
10 SASI_Mm02_00323650 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016859
VALIDATED
BYSL MISSION shRNA Bacterial Glycerol Stock
bystin-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016859.3-1391s21c1
Sequence:CCGGACGCTCTGGTCTTCCACTTTCCTCGAGGAAAGTGGAAGACCAGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-771s21c1
Sequence:CCGGCATGGAGAAGTTGACGGAGAACTCGAGTTCTCCGTCAACTTCTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-1092s21c1
Sequence:CCGGGCGAGATGACATTGCTGAATACTCGAGTATTCAGCAATGTCATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-1468s21c1
Sequence:CCGGACACTAGCGCAGCGCTATAAGCTCGAGCTTATAGCGCTGCGCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-1861s21c1
Sequence:CCGGCCCACCTGGCAGTTGGTATAACTCGAGTTATACCAACTGCCAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016859.2-763s1c1
Sequence:CCGGCATGGAGAAGTTGACGGAGAACTCGAGTTCTCCGTCAACTTCTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016859.2-1285s1c1
Sequence:CCGGCATGCTGAAGATCGCAGAAATCTCGAGATTTCTGCGATCTTCAGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016859.2-2074s1c1
Sequence:CCGGCCCACCTTATTCTTCAAAGTTCTCGAGAACTTTGAAGAATAAGGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016859.2-997s1c1
Sequence:CCGGCATGTATCAAGCCACCAGGATCTCGAGATCCTGGTGGCTTGATACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016859.2-1164s1c1
Sequence:CCGGCCTGGTTCAAAGGAATCCTGACTCGAGTCAGGATTCCTTTGAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016859
VALIDATED
BYSL MISSION shRNA shRNA Plasmid DNA
bystin-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016859.3-1391s21c1
Sequence:CCGGACGCTCTGGTCTTCCACTTTCCTCGAGGAAAGTGGAAGACCAGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-771s21c1
Sequence:CCGGCATGGAGAAGTTGACGGAGAACTCGAGTTCTCCGTCAACTTCTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-1092s21c1
Sequence:CCGGGCGAGATGACATTGCTGAATACTCGAGTATTCAGCAATGTCATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-1468s21c1
Sequence:CCGGACACTAGCGCAGCGCTATAAGCTCGAGCTTATAGCGCTGCGCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-1861s21c1
Sequence:CCGGCCCACCTGGCAGTTGGTATAACTCGAGTTATACCAACTGCCAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016859.2-763s1c1
Sequence:CCGGCATGGAGAAGTTGACGGAGAACTCGAGTTCTCCGTCAACTTCTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016859.2-1285s1c1
Sequence:CCGGCATGCTGAAGATCGCAGAAATCTCGAGATTTCTGCGATCTTCAGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016859.2-2074s1c1
Sequence:CCGGCCCACCTTATTCTTCAAAGTTCTCGAGAACTTTGAAGAATAAGGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016859.2-997s1c1
Sequence:CCGGCATGTATCAAGCCACCAGGATCTCGAGATCCTGGTGGCTTGATACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016859.2-1164s1c1
Sequence:CCGGCCTGGTTCAAAGGAATCCTGACTCGAGTCAGGATTCCTTTGAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016859
VALIDATED
BYSL MISSION shRNA Lentiviral Transduction Particles
bystin-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016859.3-1391s21c1
Sequence:CCGGACGCTCTGGTCTTCCACTTTCCTCGAGGAAAGTGGAAGACCAGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-771s21c1
Sequence:CCGGCATGGAGAAGTTGACGGAGAACTCGAGTTCTCCGTCAACTTCTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-1092s21c1
Sequence:CCGGGCGAGATGACATTGCTGAATACTCGAGTATTCAGCAATGTCATCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-1468s21c1
Sequence:CCGGACACTAGCGCAGCGCTATAAGCTCGAGCTTATAGCGCTGCGCTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016859.3-1861s21c1
Sequence:CCGGCCCACCTGGCAGTTGGTATAACTCGAGTTATACCAACTGCCAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016859.2-763s1c1
Sequence:CCGGCATGGAGAAGTTGACGGAGAACTCGAGTTCTCCGTCAACTTCTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016859.2-1285s1c1
Sequence:CCGGCATGCTGAAGATCGCAGAAATCTCGAGATTTCTGCGATCTTCAGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016859.2-2074s1c1
Sequence:CCGGCCCACCTTATTCTTCAAAGTTCTCGAGAACTTTGAAGAATAAGGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016859.2-997s1c1
Sequence:CCGGCATGTATCAAGCCACCAGGATCTCGAGATCCTGGTGGCTTGATACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016859.2-1164s1c1
Sequence:CCGGCCTGGTTCAAAGGAATCCTGACTCGAGTCAGGATTCCTTTGAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004053
VALIDATED
BYSL MISSION shRNA Bacterial Glycerol Stock
bystin-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004053.3-936s21c1
Sequence:CCGGGCCCAAGGCATTTAAGATCATCTCGAGATGATCTTAAATGCCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004053.3-1831s21c1
Sequence:CCGGCTTCCATTCTAGGCCCTTATCCTCGAGGATAAGGGCCTAGAATGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004053.3-1114s21c1
Sequence:CCGGGATGACGTTGCTGAATACAAACTCGAGTTTGTATTCAGCAACGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004053.3-898s21c1
Sequence:CCGGGTCCGGGAGGTATTATCTAAGCTCGAGCTTAGATAATACCTCCCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004053.3-1371s21c1
Sequence:CCGGGCTGGATAAGAAGTATGCACTCTCGAGAGTGCATACTTCTTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004053.2-514s1c1
Sequence:CCGGGCTGACATCATCATGGAGAAGCTCGAGCTTCTCCATGATGATGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004053.2-850s1c1
Sequence:CCGGGATGACGTTGCTGAATACAAACTCGAGTTTGTATTCAGCAACGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004053.2-1107s1c1
Sequence:CCGGGCTGGATAAGAAGTATGCACTCTCGAGAGTGCATACTTCTTATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004053.2-672s1c1
Sequence:CCGGGCCCAAGGCATTTAAGATCATCTCGAGATGATCTTAAATGCCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004053.2-551s1c1
Sequence:CCGGCAGAGGTTGAGACAGTCATGTCTCGAGACATGACTGTCTCAACCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004053
VALIDATED
BYSL MISSION shRNA shRNA Plasmid DNA
bystin-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004053.3-936s21c1
Sequence:CCGGGCCCAAGGCATTTAAGATCATCTCGAGATGATCTTAAATGCCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004053.3-1831s21c1
Sequence:CCGGCTTCCATTCTAGGCCCTTATCCTCGAGGATAAGGGCCTAGAATGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004053.3-1114s21c1
Sequence:CCGGGATGACGTTGCTGAATACAAACTCGAGTTTGTATTCAGCAACGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004053.3-898s21c1
Sequence:CCGGGTCCGGGAGGTATTATCTAAGCTCGAGCTTAGATAATACCTCCCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004053.3-1371s21c1
Sequence:CCGGGCTGGATAAGAAGTATGCACTCTCGAGAGTGCATACTTCTTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004053.2-514s1c1
Sequence:CCGGGCTGACATCATCATGGAGAAGCTCGAGCTTCTCCATGATGATGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004053.2-850s1c1
Sequence:CCGGGATGACGTTGCTGAATACAAACTCGAGTTTGTATTCAGCAACGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004053.2-1107s1c1
Sequence:CCGGGCTGGATAAGAAGTATGCACTCTCGAGAGTGCATACTTCTTATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004053.2-672s1c1
Sequence:CCGGGCCCAAGGCATTTAAGATCATCTCGAGATGATCTTAAATGCCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004053.2-551s1c1
Sequence:CCGGCAGAGGTTGAGACAGTCATGTCTCGAGACATGACTGTCTCAACCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004053
VALIDATED
BYSL MISSION shRNA Lentiviral Transduction Particles
bystin-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004053.3-936s21c1
Sequence:CCGGGCCCAAGGCATTTAAGATCATCTCGAGATGATCTTAAATGCCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004053.3-1831s21c1
Sequence:CCGGCTTCCATTCTAGGCCCTTATCCTCGAGGATAAGGGCCTAGAATGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004053.3-1114s21c1
Sequence:CCGGGATGACGTTGCTGAATACAAACTCGAGTTTGTATTCAGCAACGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004053.3-898s21c1
Sequence:CCGGGTCCGGGAGGTATTATCTAAGCTCGAGCTTAGATAATACCTCCCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004053.3-1371s21c1
Sequence:CCGGGCTGGATAAGAAGTATGCACTCTCGAGAGTGCATACTTCTTATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004053.2-514s1c1
Sequence:CCGGGCTGACATCATCATGGAGAAGCTCGAGCTTCTCCATGATGATGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004053.2-850s1c1
Sequence:CCGGGATGACGTTGCTGAATACAAACTCGAGTTTGTATTCAGCAACGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004053.2-1107s1c1
Sequence:CCGGGCTGGATAAGAAGTATGCACTCTCGAGAGTGCATACTTCTTATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004053.2-672s1c1
Sequence:CCGGGCCCAAGGCATTTAAGATCATCTCGAGATGATCTTAAATGCCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004053.2-551s1c1
Sequence:CCGGCAGAGGTTGAGACAGTCATGTCTCGAGACATGACTGTCTCAACCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)