EMAIL THIS PAGE TO A FRIEND

C10orf12

chromosome 10 open reading frame 12

83 Gene Product Result for
UniProtKB ID: Q8N655, Q9H945, Q9Y457
Gene ID:
chicken(428970) chromosome 6 open reading frame, human C10orf12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100234 Anti-C10ORF12 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015652 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041121 MISSION® esiRNA esiRNA human C10orf12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015652 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173907 predicted 377
2 SASI_Hs01_00173909 predicted 3203
3 SASI_Hs01_00173911 predicted 519
4 SASI_Hs01_00173912 predicted 267
5 SASI_Hs01_00173913 predicted 2804
6 SASI_Hs01_00173914 predicted 3854
7 SASI_Hs01_00173915 predicted 2300
8 SASI_Hs02_00348259 predicted 2847
9 SASI_Hs02_00348260 predicted 3194
10 SASI_Hs02_00348261 predicted 1535
11 SASI_Hs01_00173906 predicted 2009
12 SASI_Hs01_00173908 predicted 2685
13 SASI_Hs01_00173910 predicted 1541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015652
C10orf12 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015652.2-468s1c1
Sequence:CCGGGCTGTACACAAAGCGGCAAATCTCGAGATTTGCCGCTTTGTGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015652.2-1937s1c1
Sequence:CCGGCAAGGAGTTACGAGGAGAGATCTCGAGATCTCTCCTCGTAACTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015652.2-3855s1c1
Sequence:CCGGGAAAGATGGTAGCCAAGAGTACTCGAGTACTCTTGGCTACCATCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015652.2-4033s1c1
Sequence:CCGGCTGAGGCTAAGGGAAGTTATACTCGAGTATAACTTCCCTTAGCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015652.2-3971s1c1
Sequence:CCGGCCGTAATTTGAGATGTCAGAACTCGAGTTCTGACATCTCAAATTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015652.2-3143s1c1
Sequence:CCGGCCAGCAACGTTTAATCAAGAACTCGAGTTCTTGATTAAACGTTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015652.2-2836s21c1
Sequence:CCGGACGCTCCTTCCAGCCTATATCCTCGAGGATATAGGCTGGAAGGAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015652.2-549s21c1
Sequence:CCGGGCATCAGGGCTGAGGATAAATCTCGAGATTTATCCTCAGCCCTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015652
C10orf12 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015652.2-468s1c1
Sequence:CCGGGCTGTACACAAAGCGGCAAATCTCGAGATTTGCCGCTTTGTGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015652.2-1937s1c1
Sequence:CCGGCAAGGAGTTACGAGGAGAGATCTCGAGATCTCTCCTCGTAACTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015652.2-3855s1c1
Sequence:CCGGGAAAGATGGTAGCCAAGAGTACTCGAGTACTCTTGGCTACCATCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015652.2-4033s1c1
Sequence:CCGGCTGAGGCTAAGGGAAGTTATACTCGAGTATAACTTCCCTTAGCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015652.2-3971s1c1
Sequence:CCGGCCGTAATTTGAGATGTCAGAACTCGAGTTCTGACATCTCAAATTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015652.2-3143s1c1
Sequence:CCGGCCAGCAACGTTTAATCAAGAACTCGAGTTCTTGATTAAACGTTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015652.2-2836s21c1
Sequence:CCGGACGCTCCTTCCAGCCTATATCCTCGAGGATATAGGCTGGAAGGAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015652.2-549s21c1
Sequence:CCGGGCATCAGGGCTGAGGATAAATCTCGAGATTTATCCTCAGCCCTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015652
C10orf12 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015652.2-468s1c1
Sequence:CCGGGCTGTACACAAAGCGGCAAATCTCGAGATTTGCCGCTTTGTGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015652.2-1937s1c1
Sequence:CCGGCAAGGAGTTACGAGGAGAGATCTCGAGATCTCTCCTCGTAACTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015652.2-3855s1c1
Sequence:CCGGGAAAGATGGTAGCCAAGAGTACTCGAGTACTCTTGGCTACCATCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015652.2-4033s1c1
Sequence:CCGGCTGAGGCTAAGGGAAGTTATACTCGAGTATAACTTCCCTTAGCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015652.2-3971s1c1
Sequence:CCGGCCGTAATTTGAGATGTCAGAACTCGAGTTCTGACATCTCAAATTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015652.2-3143s1c1
Sequence:CCGGCCAGCAACGTTTAATCAAGAACTCGAGTTCTTGATTAAACGTTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015652.2-2836s21c1
Sequence:CCGGACGCTCCTTCCAGCCTATATCCTCGAGGATATAGGCTGGAAGGAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015652.2-549s21c1
Sequence:CCGGGCATCAGGGCTGAGGATAAATCTCGAGATTTATCCTCAGCCCTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)