EMAIL THIS PAGE TO A FRIEND

C10orf95

chromosome 10 open reading frame 95

15 Gene Product Result for
Species: Human C10orf95(79946)
UniProtKB ID: Q9H7T3, A0AVQ7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024886 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024886 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042532 predicted 1078
2 SASI_Hs01_00042533 predicted 1010
3 SASI_Hs01_00042534 predicted 1008
4 SASI_Hs01_00042535 predicted 986
5 SASI_Hs01_00042536 predicted 201
6 SASI_Hs01_00042537 predicted 624
7 SASI_Hs01_00042538 predicted 991
8 SASI_Hs01_00042539 predicted 370
9 SASI_Hs01_00042540 predicted 1052
10 SASI_Hs01_00042541 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024886
C10orf95 MISSION shRNA Bacterial Glycerol Stock
chromosome 10 open reading frame 95
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024886.1-1234s21c1
Sequence:CCGGTTCCCTCTATCAGAGTCGTCGCTCGAGCGACGACTCTGATAGAGGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024886.1-1179s21c1
Sequence:CCGGCCACCTTCTCCTAAGGAGCTTCTCGAGAAGCTCCTTAGGAGAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024886.1-205s21c1
Sequence:CCGGGGCCGACCATGTATGTGTACACTCGAGTGTACACATACATGGTCGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024886.1-1018s1c1
Sequence:CCGGCACTTGTTTCTCTCGCTTTATCTCGAGATAAAGCGAGAGAAACAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024886.1-1214s1c1
Sequence:CCGGCCCAACTTTCCCTTCCTCTTTCTCGAGAAAGAGGAAGGGAAAGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024886.1-1006s1c1
Sequence:CCGGGCCAGTTTCCTGCACTTGTTTCTCGAGAAACAAGTGCAGGAAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024886.1-146s1c1
Sequence:CCGGCTGAAGGAGACAAGTCTGGATCTCGAGATCCAGACTTGTCTCCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024886
C10orf95 MISSION shRNA shRNA Plasmid DNA
chromosome 10 open reading frame 95
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024886.1-1234s21c1
Sequence:CCGGTTCCCTCTATCAGAGTCGTCGCTCGAGCGACGACTCTGATAGAGGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024886.1-1179s21c1
Sequence:CCGGCCACCTTCTCCTAAGGAGCTTCTCGAGAAGCTCCTTAGGAGAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024886.1-205s21c1
Sequence:CCGGGGCCGACCATGTATGTGTACACTCGAGTGTACACATACATGGTCGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024886.1-1018s1c1
Sequence:CCGGCACTTGTTTCTCTCGCTTTATCTCGAGATAAAGCGAGAGAAACAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024886.1-1214s1c1
Sequence:CCGGCCCAACTTTCCCTTCCTCTTTCTCGAGAAAGAGGAAGGGAAAGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024886.1-1006s1c1
Sequence:CCGGGCCAGTTTCCTGCACTTGTTTCTCGAGAAACAAGTGCAGGAAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024886.1-146s1c1
Sequence:CCGGCTGAAGGAGACAAGTCTGGATCTCGAGATCCAGACTTGTCTCCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024886
C10orf95 MISSION shRNA Lentiviral Transduction Particles
chromosome 10 open reading frame 95
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024886.1-1234s21c1
Sequence:CCGGTTCCCTCTATCAGAGTCGTCGCTCGAGCGACGACTCTGATAGAGGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024886.1-1179s21c1
Sequence:CCGGCCACCTTCTCCTAAGGAGCTTCTCGAGAAGCTCCTTAGGAGAAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024886.1-205s21c1
Sequence:CCGGGGCCGACCATGTATGTGTACACTCGAGTGTACACATACATGGTCGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024886.1-1018s1c1
Sequence:CCGGCACTTGTTTCTCTCGCTTTATCTCGAGATAAAGCGAGAGAAACAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024886.1-1214s1c1
Sequence:CCGGCCCAACTTTCCCTTCCTCTTTCTCGAGAAAGAGGAAGGGAAAGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024886.1-1006s1c1
Sequence:CCGGGCCAGTTTCCTGCACTTGTTTCTCGAGAAACAAGTGCAGGAAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024886.1-146s1c1
Sequence:CCGGCTGAAGGAGACAAGTCTGGATCTCGAGATCCAGACTTGTCTCCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)