EMAIL THIS PAGE TO A FRIEND

C11orf1

chromosome 11 open reading frame 1

30 Gene Product Result for
Species: Human C11orf1(64776)
UniProtKB ID: Q9H5F2, Q6I9X7, Q9NQC6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022761 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035571 MISSION® esiRNA esiRNA human C11orf1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022761 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356024 predicted 661
2 SASI_Hs02_00356025 predicted 449
3 SASI_Hs02_00356026 predicted 374
4 SASI_Hs02_00356027 predicted 443
5 SASI_Hs01_00143291 predicted 565
6 SASI_Hs02_00356028 predicted 463
7 SASI_Hs02_00356029 predicted 494
8 SASI_Hs01_00143293 predicted 665
9 SASI_Hs01_00143294 predicted 733
10 SASI_Hs02_00356030 predicted 606
11 SASI_Hs01_00143290 predicted 475
12 SASI_Hs01_00143292 predicted 349
13 SASI_Hs01_00143295 predicted 537
14 SASI_Hs01_00143296 predicted 519
15 SASI_Hs01_00143297 predicted 351
16 SASI_Hs01_00143298 predicted 464
17 SASI_Hs01_00143299 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022761
VALIDATED
C11orf1 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022761.1-185s1c1
Sequence:CCGGGCGATGCACCACTAATGAGAACTCGAGTTCTCATTAGTGGTGCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022761.1-584s1c1
Sequence:CCGGGCACATTCTAAGTACAGCTAACTCGAGTTAGCTGTACTTAGAATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022761.1-2326s1c1
Sequence:CCGGGCCCATATGTTGTCCTCGTAACTCGAGTTACGAGGACAACATATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022761.1-294s1c1
Sequence:CCGGCAGTTTGGACACTACTTTGAACTCGAGTTCAAAGTAGTGTCCAAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022761.1-140s1c1
Sequence:CCGGGTGGACAGACTGGAATAATATCTCGAGATATTATTCCAGTCTGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022761.1-246s1c1
Sequence:CCGGGAAAGATATGACCTGAGGAATCTCGAGATTCCTCAGGTCATATCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022761.1-190s1c1
Sequence:CCGGGCACCACTAATGAGAATACCTCTCGAGAGGTATTCTCATTAGTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022761.1-2339s1c1
Sequence:CCGGCCTCGTAAGCAAGGAGATATTCTCGAGAATATCTCCTTGCTTACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022761.2-383s21c1
Sequence:CCGGAGACAGAACCTCGCCTGTTTCCTCGAGGAAACAGGCGAGGTTCTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022761.2-448s21c1
Sequence:CCGGTGGTGAAGTGTGGACAGATTGCTCGAGCAATCTGTCCACACTTCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022761.2-774s21c1
Sequence:CCGGGCTATTCAAAGCCTTAAATTGCTCGAGCAATTTAAGGCTTTGAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022761
VALIDATED
C11orf1 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022761.1-185s1c1
Sequence:CCGGGCGATGCACCACTAATGAGAACTCGAGTTCTCATTAGTGGTGCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022761.1-584s1c1
Sequence:CCGGGCACATTCTAAGTACAGCTAACTCGAGTTAGCTGTACTTAGAATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022761.1-2326s1c1
Sequence:CCGGGCCCATATGTTGTCCTCGTAACTCGAGTTACGAGGACAACATATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022761.1-294s1c1
Sequence:CCGGCAGTTTGGACACTACTTTGAACTCGAGTTCAAAGTAGTGTCCAAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022761.1-140s1c1
Sequence:CCGGGTGGACAGACTGGAATAATATCTCGAGATATTATTCCAGTCTGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022761.1-246s1c1
Sequence:CCGGGAAAGATATGACCTGAGGAATCTCGAGATTCCTCAGGTCATATCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022761.1-190s1c1
Sequence:CCGGGCACCACTAATGAGAATACCTCTCGAGAGGTATTCTCATTAGTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022761.1-2339s1c1
Sequence:CCGGCCTCGTAAGCAAGGAGATATTCTCGAGAATATCTCCTTGCTTACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022761.2-383s21c1
Sequence:CCGGAGACAGAACCTCGCCTGTTTCCTCGAGGAAACAGGCGAGGTTCTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022761.2-448s21c1
Sequence:CCGGTGGTGAAGTGTGGACAGATTGCTCGAGCAATCTGTCCACACTTCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022761.2-774s21c1
Sequence:CCGGGCTATTCAAAGCCTTAAATTGCTCGAGCAATTTAAGGCTTTGAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022761
VALIDATED
C11orf1 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022761.1-185s1c1
Sequence:CCGGGCGATGCACCACTAATGAGAACTCGAGTTCTCATTAGTGGTGCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022761.1-584s1c1
Sequence:CCGGGCACATTCTAAGTACAGCTAACTCGAGTTAGCTGTACTTAGAATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022761.1-2326s1c1
Sequence:CCGGGCCCATATGTTGTCCTCGTAACTCGAGTTACGAGGACAACATATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022761.1-294s1c1
Sequence:CCGGCAGTTTGGACACTACTTTGAACTCGAGTTCAAAGTAGTGTCCAAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022761.1-140s1c1
Sequence:CCGGGTGGACAGACTGGAATAATATCTCGAGATATTATTCCAGTCTGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022761.1-246s1c1
Sequence:CCGGGAAAGATATGACCTGAGGAATCTCGAGATTCCTCAGGTCATATCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022761.1-190s1c1
Sequence:CCGGGCACCACTAATGAGAATACCTCTCGAGAGGTATTCTCATTAGTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022761.1-2339s1c1
Sequence:CCGGCCTCGTAAGCAAGGAGATATTCTCGAGAATATCTCCTTGCTTACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022761.2-383s21c1
Sequence:CCGGAGACAGAACCTCGCCTGTTTCCTCGAGGAAACAGGCGAGGTTCTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022761.2-448s21c1
Sequence:CCGGTGGTGAAGTGTGGACAGATTGCTCGAGCAATCTGTCCACACTTCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022761.2-774s21c1
Sequence:CCGGGCTATTCAAAGCCTTAAATTGCTCGAGCAATTTAAGGCTTTGAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)