EMAIL THIS PAGE TO A FRIEND

C11orf65

chromosome 11 open reading frame 65

25 Gene Product Result for
Species: Human C11orf65(160140)
UniProtKB ID: Q8NCR3, Q6PCA8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152587 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152587 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152587 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152587 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366415 predicted 673
2 SASI_Hs01_00050984 predicted 624
3 SASI_Hs02_00366416 predicted 309
4 SASI_Hs02_00366417 predicted 289
5 SASI_Hs01_00050992 predicted 732
6 SASI_Hs02_00366418 predicted 783
7 SASI_Hs02_00366419 predicted 357
8 SASI_Hs02_00366420 predicted 230
9 SASI_Hs02_00366421 predicted 280
10 SASI_Hs02_00366422 predicted 648
11 SASI_Hs01_00050985 predicted 459
12 SASI_Hs01_00050986 predicted 1117
13 SASI_Hs01_00050987 predicted 218
14 SASI_Hs01_00050988 predicted 975
15 SASI_Hs01_00050989 predicted 1100
16 SASI_Hs01_00050990 predicted 1090
17 SASI_Hs01_00050991 predicted 606
18 SASI_Hs01_00050993 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152587
C11orf65 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 65
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-876s1c1
Sequence:CCGGGCTGGAAGGAAATTGCTACAACTCGAGTTGTAGCAATTTCCTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-966s1c1
Sequence:CCGGGAGACATATCAAAGATGCAAACTCGAGTTTGCATCTTTGATATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-513s1c1
Sequence:CCGGGCTGGTATCATCGTATAGAAACTCGAGTTTCTATACGATGATACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-345s1c1
Sequence:CCGGGATTCAGATTAGGTGGAGTTACTCGAGTAACTCCACCTAATCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-344s1c1
Sequence:CCGGCGATTCAGATTAGGTGGAGTTCTCGAGAACTCCACCTAATCTGAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152587.3-396s21c1
Sequence:CCGGCAAAGCATACATCTCATAATACTCGAGTATTATGAGATGTATGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152587.3-983s21c1
Sequence:CCGGTTAACGCCTGATTCTACTTATCTCGAGATAAGTAGAATCAGGCGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152587.3-669s21c1
Sequence:CCGGATGAAACTCTAGGACTAATTCCTCGAGGAATTAGTCCTAGAGTTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152587
C11orf65 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 65
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-876s1c1
Sequence:CCGGGCTGGAAGGAAATTGCTACAACTCGAGTTGTAGCAATTTCCTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-966s1c1
Sequence:CCGGGAGACATATCAAAGATGCAAACTCGAGTTTGCATCTTTGATATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-513s1c1
Sequence:CCGGGCTGGTATCATCGTATAGAAACTCGAGTTTCTATACGATGATACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-345s1c1
Sequence:CCGGGATTCAGATTAGGTGGAGTTACTCGAGTAACTCCACCTAATCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-344s1c1
Sequence:CCGGCGATTCAGATTAGGTGGAGTTCTCGAGAACTCCACCTAATCTGAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152587.3-396s21c1
Sequence:CCGGCAAAGCATACATCTCATAATACTCGAGTATTATGAGATGTATGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152587.3-983s21c1
Sequence:CCGGTTAACGCCTGATTCTACTTATCTCGAGATAAGTAGAATCAGGCGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152587.3-669s21c1
Sequence:CCGGATGAAACTCTAGGACTAATTCCTCGAGGAATTAGTCCTAGAGTTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152587
C11orf65 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 65
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-876s1c1
Sequence:CCGGGCTGGAAGGAAATTGCTACAACTCGAGTTGTAGCAATTTCCTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-966s1c1
Sequence:CCGGGAGACATATCAAAGATGCAAACTCGAGTTTGCATCTTTGATATGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-513s1c1
Sequence:CCGGGCTGGTATCATCGTATAGAAACTCGAGTTTCTATACGATGATACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-345s1c1
Sequence:CCGGGATTCAGATTAGGTGGAGTTACTCGAGTAACTCCACCTAATCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152587.2-344s1c1
Sequence:CCGGCGATTCAGATTAGGTGGAGTTCTCGAGAACTCCACCTAATCTGAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152587.3-396s21c1
Sequence:CCGGCAAAGCATACATCTCATAATACTCGAGTATTATGAGATGTATGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152587.3-983s21c1
Sequence:CCGGTTAACGCCTGATTCTACTTATCTCGAGATAAGTAGAATCAGGCGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152587.3-669s21c1
Sequence:CCGGATGAAACTCTAGGACTAATTCCTCGAGGAATTAGTCCTAGAGTTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)