EMAIL THIS PAGE TO A FRIEND

C11orf95

chromosome 11 open reading frame 95

42 Gene Product Result for
Species: Human C11orf95(65998)
UniProtKB ID: C9JLR9, A6NLS7, Q3C1V4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144936 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715390 Rosetta Predictions human pricing
XM_933539 Rosetta Predictions human pricing
XM_944529 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00403349 predicted 765
2 SASI_Hs02_00403350 predicted 219
3 SASI_Hs02_00403351 predicted 766
4 SASI_Hs02_00403352 predicted 226
5 SASI_Hs02_00403353 predicted 260
6 SASI_Hs02_00403354 predicted 219
7 SASI_Hs02_00403355 predicted 251
8 SASI_Hs02_00403356 predicted 255
9 SASI_Hs02_00403357 predicted 223
10 SASI_Hs02_00403358 predicted 196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00481641 predicted 3166
2 SASI_Hs02_00481642 predicted 3048
3 SASI_Hs02_00481643 predicted 3052
4 SASI_Hs02_00481644 predicted 3045
5 SASI_Hs01_00284136 predicted 1873
6 SASI_Hs02_00481645 predicted 3037
7 SASI_Hs02_00481646 predicted 102
8 SASI_Hs02_00481647 predicted 103
9 SASI_Hs01_00284138 predicted 333
10 SASI_Hs01_00284139 predicted 1579
11 SASI_Hs01_00284137 predicted 1050
12 SASI_Hs01_00284140 predicted 1109
13 SASI_Hs01_00284141 predicted 1224
14 SASI_Hs01_00284142 predicted 612
15 SASI_Hs01_00284143 predicted 1064
16 SASI_Hs01_00284144 predicted 1101
17 SASI_Hs01_00284145 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_944529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00486498 predicted 3090
2 SASI_Hs02_00486499 predicted 2970
3 SASI_Hs02_00486500 predicted 2976
4 SASI_Hs02_00486501 predicted 2976
5 SASI_Hs02_00486502 predicted 1797
6 SASI_Hs02_00486503 predicted 2968
7 SASI_Hs02_00486504 predicted 101
8 SASI_Hs02_00486505 predicted 100
9 SASI_Hs02_00486506 predicted 332
10 SASI_Hs02_00486507 predicted 1508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144936
C11orf95 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 95
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-241s21c1
Sequence:CCGGATCTTCAGGCAGGAAATATTCCTCGAGGAATATTTCCTGCCTGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-353s21c1
Sequence:CCGGGAGTACCTGATGGACTTCAACCTCGAGGTTGAAGTCCATCAGGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-1852s21c1
Sequence:CCGGGCTCAAGGTGAGCACCATCAACTCGAGTTGATGGTGCTCACCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-828s21c1
Sequence:CCGGCCGAGTGTCTCATGGACTATGCTCGAGCATAGTCCATGAGACACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-424s21c1
Sequence:CCGGCCTCAAGCTCAGCACCATCAACTCGAGTTGATGGTGCTGAGCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144936
C11orf95 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 95
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-241s21c1
Sequence:CCGGATCTTCAGGCAGGAAATATTCCTCGAGGAATATTTCCTGCCTGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-353s21c1
Sequence:CCGGGAGTACCTGATGGACTTCAACCTCGAGGTTGAAGTCCATCAGGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-1852s21c1
Sequence:CCGGGCTCAAGGTGAGCACCATCAACTCGAGTTGATGGTGCTCACCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-828s21c1
Sequence:CCGGCCGAGTGTCTCATGGACTATGCTCGAGCATAGTCCATGAGACACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-424s21c1
Sequence:CCGGCCTCAAGCTCAGCACCATCAACTCGAGTTGATGGTGCTGAGCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144936
C11orf95 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 95
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-241s21c1
Sequence:CCGGATCTTCAGGCAGGAAATATTCCTCGAGGAATATTTCCTGCCTGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-353s21c1
Sequence:CCGGGAGTACCTGATGGACTTCAACCTCGAGGTTGAAGTCCATCAGGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-1852s21c1
Sequence:CCGGGCTCAAGGTGAGCACCATCAACTCGAGTTGATGGTGCTCACCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-828s21c1
Sequence:CCGGCCGAGTGTCTCATGGACTATGCTCGAGCATAGTCCATGAGACACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144936.1-424s21c1
Sequence:CCGGCCTCAAGCTCAGCACCATCAACTCGAGTTGATGGTGCTGAGCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)