EMAIL THIS PAGE TO A FRIEND

C14orf93

chromosome 14 open reading frame 93

25 Gene Product Result for
Species: Human C14orf93(60686)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA002569 Anti-C14orf93 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021944 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099271 MISSION® esiRNA esiRNA human C14orf93 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021944 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238145 predicted 617
2 SASI_Hs01_00238146 predicted 1714
3 SASI_Hs01_00238147 predicted 672
4 SASI_Hs01_00238148 predicted 483
5 SASI_Hs01_00238151 predicted 1296
6 SASI_Hs01_00238153 predicted 1378
7 SASI_Hs02_00355263 predicted 1325
8 SASI_Hs02_00355264 predicted 1248
9 SASI_Hs02_00355265 predicted 2042
10 SASI_Hs02_00355266 predicted 495
11 SASI_Hs01_00238149 predicted 1406
12 SASI_Hs01_00238150 predicted 1341
13 SASI_Hs01_00238152 predicted 734
14 SASI_Hs01_00238154 predicted 1702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021944
C14orf93 MISSION shRNA Bacterial Glycerol Stock
chromosome 14 open reading frame 93
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-488s1c2
Sequence:CCGGCGCCTGTAAGAGTGAGACTAACTCGAGTTAGTCTCACTCTTACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021944.1-2187s1c1
Sequence:CCGGGCAGAACACTGGTGGGATAAACTCGAGTTTATCCCACCAGTGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-1526s1c1
Sequence:CCGGCCTTACTAAGAGGCGTGAGTACTCGAGTACTCACGCCTCTTAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-1890s1c1
Sequence:CCGGCCAGAACTTTACAATCCTAATCTCGAGATTAGGATTGTAAAGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-1323s1c1
Sequence:CCGGCGGGATCTTGTACTCTCTAAACTCGAGTTTAGAGAGTACAAGATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021944
C14orf93 MISSION shRNA shRNA Plasmid DNA
chromosome 14 open reading frame 93
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-488s1c2
Sequence:CCGGCGCCTGTAAGAGTGAGACTAACTCGAGTTAGTCTCACTCTTACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021944.1-2187s1c1
Sequence:CCGGGCAGAACACTGGTGGGATAAACTCGAGTTTATCCCACCAGTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-1526s1c1
Sequence:CCGGCCTTACTAAGAGGCGTGAGTACTCGAGTACTCACGCCTCTTAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-1890s1c1
Sequence:CCGGCCAGAACTTTACAATCCTAATCTCGAGATTAGGATTGTAAAGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-1323s1c1
Sequence:CCGGCGGGATCTTGTACTCTCTAAACTCGAGTTTAGAGAGTACAAGATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021944
C14orf93 MISSION shRNA Lentiviral Transduction Particles
chromosome 14 open reading frame 93
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-488s1c2
Sequence:CCGGCGCCTGTAAGAGTGAGACTAACTCGAGTTAGTCTCACTCTTACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021944.1-2187s1c1
Sequence:CCGGGCAGAACACTGGTGGGATAAACTCGAGTTTATCCCACCAGTGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-1526s1c1
Sequence:CCGGCCTTACTAAGAGGCGTGAGTACTCGAGTACTCACGCCTCTTAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-1890s1c1
Sequence:CCGGCCAGAACTTTACAATCCTAATCTCGAGATTAGGATTGTAAAGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021944.1-1323s1c1
Sequence:CCGGCGGGATCTTGTACTCTCTAAACTCGAGTTTAGAGAGTACAAGATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)