EMAIL THIS PAGE TO A FRIEND

C15orf53

chromosome 15 open reading frame 53

47 Gene Product Result for
Species: Human C15orf53(400359)
UniProtKB ID: Q8NAA6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207444 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026221 MISSION® esiRNA esiRNA human C15orf53 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207444 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134819 predicted 487
2 SASI_Hs01_00134820 predicted 197
3 SASI_Hs01_00134821 predicted 880
4 SASI_Hs01_00134822 predicted 628
5 SASI_Hs01_00134824 predicted 551
6 SASI_Hs01_00134825 predicted 794
7 SASI_Hs01_00134826 predicted 567
8 SASI_Hs01_00134827 predicted 792
9 SASI_Hs01_00134828 predicted 873
10 SASI_Hs02_00374086 predicted 765
11 SASI_Hs01_00134823 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207444
C15orf53 MISSION shRNA Bacterial Glycerol Stock
chromosome 15 open reading frame 53
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-320s1c1
Sequence:CCGGGCATGGATCTCCTGCATTACACTCGAGTGTAATGCAGGAGATCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-260s1c1
Sequence:CCGGGCTGGCAAGTTGATACAAGCTCTCGAGAGCTTGTATCAACTTGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207444.1-1790s1c1
Sequence:CCGGCCAGACTTCTTGGATGGACATCTCGAGATGTCCATCCAAGAAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-282s1c1
Sequence:CCGGCAGCTCATGTCTTCAGACAATCTCGAGATTGTCTGAAGACATGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207444.1-1633s1c1
Sequence:CCGGGCTAACCTTTCAGTGAAATAACTCGAGTTATTTCACTGAAAGGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-281s1c1
Sequence:CCGGCCAGCTCATGTCTTCAGACAACTCGAGTTGTCTGAAGACATGAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207444
C15orf53 MISSION shRNA shRNA Plasmid DNA
chromosome 15 open reading frame 53
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-320s1c1
Sequence:CCGGGCATGGATCTCCTGCATTACACTCGAGTGTAATGCAGGAGATCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-260s1c1
Sequence:CCGGGCTGGCAAGTTGATACAAGCTCTCGAGAGCTTGTATCAACTTGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207444.1-1790s1c1
Sequence:CCGGCCAGACTTCTTGGATGGACATCTCGAGATGTCCATCCAAGAAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-282s1c1
Sequence:CCGGCAGCTCATGTCTTCAGACAATCTCGAGATTGTCTGAAGACATGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207444.1-1633s1c1
Sequence:CCGGGCTAACCTTTCAGTGAAATAACTCGAGTTATTTCACTGAAAGGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-281s1c1
Sequence:CCGGCCAGCTCATGTCTTCAGACAACTCGAGTTGTCTGAAGACATGAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207444
C15orf53 MISSION shRNA Lentiviral Transduction Particles
chromosome 15 open reading frame 53
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-320s1c1
Sequence:CCGGGCATGGATCTCCTGCATTACACTCGAGTGTAATGCAGGAGATCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-260s1c1
Sequence:CCGGGCTGGCAAGTTGATACAAGCTCTCGAGAGCTTGTATCAACTTGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207444.1-1790s1c1
Sequence:CCGGCCAGACTTCTTGGATGGACATCTCGAGATGTCCATCCAAGAAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-282s1c1
Sequence:CCGGCAGCTCATGTCTTCAGACAATCTCGAGATTGTCTGAAGACATGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207444.1-1633s1c1
Sequence:CCGGGCTAACCTTTCAGTGAAATAACTCGAGTTATTTCACTGAAAGGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207444.1-281s1c1
Sequence:CCGGCCAGCTCATGTCTTCAGACAACTCGAGTTGTCTGAAGACATGAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)