EMAIL THIS PAGE TO A FRIEND

C16orf11

chromosome 16 open reading frame 11

17 Gene Product Result for
Species: Human C16orf11(146325)
UniProtKB ID: P0CG20, B8ZZ27, Q8N233, Q96AX3, Q96S23
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145270 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145270 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087828 predicted 614
2 SASI_Hs01_00087830 predicted 890
3 SASI_Hs01_00087831 predicted 413
4 SASI_Hs01_00087832 predicted 893
5 SASI_Hs01_00087833 predicted 1510
6 SASI_Hs01_00087834 predicted 1059
7 SASI_Hs01_00087835 predicted 1372
8 SASI_Hs02_00365141 predicted 1477
9 SASI_Hs01_00087837 predicted 419
10 SASI_Hs02_00365142 predicted 1988
11 SASI_Hs01_00087829 predicted 635
12 SASI_Hs01_00087836 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145270
C16orf11 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-447s21c1
Sequence:CCGGGAAGTACAGCCTCTGCAAGGACTCGAGTCCTTGCAGAGGCTGTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-383s21c1
Sequence:CCGGACAACTACAAATGCTTCCAGTCTCGAGACTGGAAGCATTTGTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-436s21c1
Sequence:CCGGTACAACCACATGAAGTACAGCCTCGAGGCTGTACTTCATGTGGTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-374s21c1
Sequence:CCGGGCAAACCCTACAACTACAAATCTCGAGATTTGTAGTTGTAGGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-428s21c1
Sequence:CCGGCACACCTCTACAACCACATGACTCGAGTCATGTGGTTGTAGAGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145270.1-433s1c1
Sequence:CCGGCTCTACAACCACATGAAGTACCTCGAGGTACTTCATGTGGTTGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-1331s21c1
Sequence:CCGGCCAGCCTGACAAGGTTCTGTTCTCGAGAACAGAACCTTGTCAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-336s21c1
Sequence:CCGGGAAGCCCAAGAAGCCACACTACTCGAGTAGTGTGGCTTCTTGGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-897s21c1
Sequence:CCGGGTCTCTGCTGGGCGTCAACTACTCGAGTAGTTGACGCCCAGCAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-420s21c1
Sequence:CCGGGGAGAAGTCACACCTCTACAACTCGAGTTGTAGAGGTGTGACTTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145270
C16orf11 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-447s21c1
Sequence:CCGGGAAGTACAGCCTCTGCAAGGACTCGAGTCCTTGCAGAGGCTGTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-383s21c1
Sequence:CCGGACAACTACAAATGCTTCCAGTCTCGAGACTGGAAGCATTTGTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-436s21c1
Sequence:CCGGTACAACCACATGAAGTACAGCCTCGAGGCTGTACTTCATGTGGTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-374s21c1
Sequence:CCGGGCAAACCCTACAACTACAAATCTCGAGATTTGTAGTTGTAGGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-428s21c1
Sequence:CCGGCACACCTCTACAACCACATGACTCGAGTCATGTGGTTGTAGAGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145270.1-433s1c1
Sequence:CCGGCTCTACAACCACATGAAGTACCTCGAGGTACTTCATGTGGTTGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-1331s21c1
Sequence:CCGGCCAGCCTGACAAGGTTCTGTTCTCGAGAACAGAACCTTGTCAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-336s21c1
Sequence:CCGGGAAGCCCAAGAAGCCACACTACTCGAGTAGTGTGGCTTCTTGGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-897s21c1
Sequence:CCGGGTCTCTGCTGGGCGTCAACTACTCGAGTAGTTGACGCCCAGCAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-420s21c1
Sequence:CCGGGGAGAAGTCACACCTCTACAACTCGAGTTGTAGAGGTGTGACTTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145270
C16orf11 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-447s21c1
Sequence:CCGGGAAGTACAGCCTCTGCAAGGACTCGAGTCCTTGCAGAGGCTGTACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-383s21c1
Sequence:CCGGACAACTACAAATGCTTCCAGTCTCGAGACTGGAAGCATTTGTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-436s21c1
Sequence:CCGGTACAACCACATGAAGTACAGCCTCGAGGCTGTACTTCATGTGGTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-374s21c1
Sequence:CCGGGCAAACCCTACAACTACAAATCTCGAGATTTGTAGTTGTAGGGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-428s21c1
Sequence:CCGGCACACCTCTACAACCACATGACTCGAGTCATGTGGTTGTAGAGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145270.1-433s1c1
Sequence:CCGGCTCTACAACCACATGAAGTACCTCGAGGTACTTCATGTGGTTGTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-1331s21c1
Sequence:CCGGCCAGCCTGACAAGGTTCTGTTCTCGAGAACAGAACCTTGTCAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-336s21c1
Sequence:CCGGGAAGCCCAAGAAGCCACACTACTCGAGTAGTGTGGCTTCTTGGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-897s21c1
Sequence:CCGGGTCTCTGCTGGGCGTCAACTACTCGAGTAGTTGACGCCCAGCAGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145270.1-420s21c1
Sequence:CCGGGGAGAAGTCACACCTCTACAACTCGAGTTGTAGAGGTGTGACTTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)