EMAIL THIS PAGE TO A FRIEND

C16orf92

chromosome 16 open reading frame 92

24 Gene Product Result for
Species: Human C16orf92(146378)
UniProtKB ID: Q96LL3, Q494R8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001109659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001109659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001109659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109659 Rosetta Predictions human pricing
NM_001109660 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324683 predicted 540
2 SASI_Hs02_00324684 predicted 536
3 SASI_Hs02_00324685 predicted 382
4 SASI_Hs02_00324686 predicted 380
5 SASI_Hs02_00324687 predicted 360
6 SASI_Hs02_00324688 predicted 533
7 SASI_Hs02_00324689 predicted 293
8 SASI_Hs02_00324690 predicted 378
9 SASI_Hs02_00324691 predicted 294
10 SASI_Hs02_00324692 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324693 predicted 617
2 SASI_Hs02_00324694 predicted 619
3 SASI_Hs02_00324695 predicted 460
4 SASI_Hs02_00324696 predicted 466
5 SASI_Hs02_00324697 predicted 438
6 SASI_Hs02_00324698 predicted 615
7 SASI_Hs02_00324699 predicted 374
8 SASI_Hs02_00324700 predicted 462
9 SASI_Hs02_00324701 predicted 377
10 SASI_Hs02_00324702 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109659
C16orf92 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 92
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109659.1-389s21c1
Sequence:CCGGCCTCTCCTGTTGATGAGCAAACTCGAGTTTGCTCATCAACAGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-204s21c1
Sequence:CCGGAGAAACCCATCGTGTTCATTACTCGAGTAATGAACACGATGGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-134s21c1
Sequence:CCGGAGACCTGACTTCTTCGATTATCTCGAGATAATCGAAGAAGTCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-312s21c1
Sequence:CCGGCCCACATAAACTTCCAGAAAGCTCGAGCTTTCTGGAAGTTTATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-273s21c1
Sequence:CCGGTGGTGGTGGCGTTCTTCTTTCCTCGAGGAAAGAAGAACGCCACCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109659
C16orf92 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 92
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109659.1-389s21c1
Sequence:CCGGCCTCTCCTGTTGATGAGCAAACTCGAGTTTGCTCATCAACAGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-204s21c1
Sequence:CCGGAGAAACCCATCGTGTTCATTACTCGAGTAATGAACACGATGGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-134s21c1
Sequence:CCGGAGACCTGACTTCTTCGATTATCTCGAGATAATCGAAGAAGTCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-312s21c1
Sequence:CCGGCCCACATAAACTTCCAGAAAGCTCGAGCTTTCTGGAAGTTTATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-273s21c1
Sequence:CCGGTGGTGGTGGCGTTCTTCTTTCCTCGAGGAAAGAAGAACGCCACCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109659
C16orf92 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 92
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109659.1-389s21c1
Sequence:CCGGCCTCTCCTGTTGATGAGCAAACTCGAGTTTGCTCATCAACAGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-204s21c1
Sequence:CCGGAGAAACCCATCGTGTTCATTACTCGAGTAATGAACACGATGGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-134s21c1
Sequence:CCGGAGACCTGACTTCTTCGATTATCTCGAGATAATCGAAGAAGTCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-312s21c1
Sequence:CCGGCCCACATAAACTTCCAGAAAGCTCGAGCTTTCTGGAAGTTTATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109659.1-273s21c1
Sequence:CCGGTGGTGGTGGCGTTCTTCTTTCCTCGAGGAAAGAAGAACGCCACCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)