EMAIL THIS PAGE TO A FRIEND

C17orf66

chromosome 17 open reading frame 66

23 Gene Product Result for
Species: Human C17orf66(256957)
UniProtKB ID: A2RTY3, B4DX21, B4DXA4, B4DXF0, Q8N4R4, Q96M46
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152781 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130631 MISSION® esiRNA esiRNA human C17orf66 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152781 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017534 predicted 1082
2 SASI_Hs01_00017535 predicted 1359
3 SASI_Hs01_00017536 predicted 1516
4 SASI_Hs01_00017537 predicted 507
5 SASI_Hs01_00017538 predicted 1062
6 SASI_Hs01_00017539 predicted 783
7 SASI_Hs02_00366722 predicted 1644
8 SASI_Hs01_00017541 predicted 354
9 SASI_Hs01_00017542 predicted 588
10 SASI_Hs01_00017543 predicted 727
11 SASI_Hs01_00017540 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152781
C17orf66 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 66
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-356s1c1
Sequence:CCGGCCCGTACTGCTACTTCAAGAACTCGAGTTCTTGAAGTAGCAGTACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-216s1c1
Sequence:CCGGGAATATCCAGACAAGACCAAACTCGAGTTTGGTCTTGTCTGGATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-517s1c1
Sequence:CCGGCAATGAGCAAGCTGACTATAACTCGAGTTATAGTCAGCTTGCTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1374s1c1
Sequence:CCGGGCACAACTGATGAACCCAGATCTCGAGATCTGGGTTCATCAGTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152781.2-516s21c1
Sequence:CCGGCCAATGAGCAAGCTGACTATACTCGAGTATAGTCAGCTTGCTCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152781.2-1654s21c1
Sequence:CCGGACCCAGAAGAGTTAACTATTCCTCGAGGAATAGTTAACTCTTCTGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152781.2-673s21c1
Sequence:CCGGTACGCATCAGTGACAAGTTTGCTCGAGCAAACTTGTCACTGATGCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1337s1c1
Sequence:CCGGGCTCAAGTTGAAGCCTACGATCTCGAGATCGTAGGCTTCAACTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1244s1c1
Sequence:CCGGGCTAGAGGAACTCACATTTAACTCGAGTTAAATGTGAGTTCCTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1349s1c1
Sequence:CCGGGCCTACGATGATGAACTTGGTCTCGAGACCAAGTTCATCATCGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152781
C17orf66 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 66
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-356s1c1
Sequence:CCGGCCCGTACTGCTACTTCAAGAACTCGAGTTCTTGAAGTAGCAGTACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-216s1c1
Sequence:CCGGGAATATCCAGACAAGACCAAACTCGAGTTTGGTCTTGTCTGGATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-517s1c1
Sequence:CCGGCAATGAGCAAGCTGACTATAACTCGAGTTATAGTCAGCTTGCTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1374s1c1
Sequence:CCGGGCACAACTGATGAACCCAGATCTCGAGATCTGGGTTCATCAGTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152781.2-516s21c1
Sequence:CCGGCCAATGAGCAAGCTGACTATACTCGAGTATAGTCAGCTTGCTCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152781.2-1654s21c1
Sequence:CCGGACCCAGAAGAGTTAACTATTCCTCGAGGAATAGTTAACTCTTCTGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152781.2-673s21c1
Sequence:CCGGTACGCATCAGTGACAAGTTTGCTCGAGCAAACTTGTCACTGATGCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1337s1c1
Sequence:CCGGGCTCAAGTTGAAGCCTACGATCTCGAGATCGTAGGCTTCAACTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1244s1c1
Sequence:CCGGGCTAGAGGAACTCACATTTAACTCGAGTTAAATGTGAGTTCCTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1349s1c1
Sequence:CCGGGCCTACGATGATGAACTTGGTCTCGAGACCAAGTTCATCATCGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152781
C17orf66 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 66
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-356s1c1
Sequence:CCGGCCCGTACTGCTACTTCAAGAACTCGAGTTCTTGAAGTAGCAGTACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-216s1c1
Sequence:CCGGGAATATCCAGACAAGACCAAACTCGAGTTTGGTCTTGTCTGGATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-517s1c1
Sequence:CCGGCAATGAGCAAGCTGACTATAACTCGAGTTATAGTCAGCTTGCTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1374s1c1
Sequence:CCGGGCACAACTGATGAACCCAGATCTCGAGATCTGGGTTCATCAGTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152781.2-516s21c1
Sequence:CCGGCCAATGAGCAAGCTGACTATACTCGAGTATAGTCAGCTTGCTCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152781.2-1654s21c1
Sequence:CCGGACCCAGAAGAGTTAACTATTCCTCGAGGAATAGTTAACTCTTCTGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152781.2-673s21c1
Sequence:CCGGTACGCATCAGTGACAAGTTTGCTCGAGCAAACTTGTCACTGATGCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1337s1c1
Sequence:CCGGGCTCAAGTTGAAGCCTACGATCTCGAGATCGTAGGCTTCAACTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1244s1c1
Sequence:CCGGGCTAGAGGAACTCACATTTAACTCGAGTTAAATGTGAGTTCCTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152781.1-1349s1c1
Sequence:CCGGGCCTACGATGATGAACTTGGTCTCGAGACCAAGTTCATCATCGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)