EMAIL THIS PAGE TO A FRIEND

C17orf76-AS1

C17orf76 antisense RNA 1

56 Gene Product Result for
Synonyms: C17orf45 NCRNA00188 TSAP19
UniProtKB ID: Q8N1F1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152350 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139601 MISSION® esiRNA esiRNA human C17orf45 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152350 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098627 predicted 408
2 SASI_Hs01_00098629 predicted 357
3 SASI_Hs01_00098630 predicted 350
4 SASI_Hs02_00365979 predicted 419
5 SASI_Hs01_00098631 predicted 401
6 SASI_Hs01_00098632 predicted 365
7 SASI_Hs01_00098633 predicted 405
8 SASI_Hs02_00365980 predicted 251
9 SASI_Hs01_00098634 predicted 248
10 SASI_Hs01_00098635 predicted 197
11 SASI_Hs01_00098628 predicted 427
12 SASI_Hs01_00098636 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152350
C17orf76-AS1 MISSION shRNA Bacterial Glycerol Stock
C17orf76 antisense RNA 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152350.1-590s1c1
Sequence:CCGGGCCATCAGTTTGGATTCTGAACTCGAGTTCAGAATCCAAACTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-435s1c1
Sequence:CCGGTGAAGAATCAGCATCATGTTTCTCGAGAAACATGATGCTGATTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-418s1c1
Sequence:CCGGACGAGGTTGCAAATTCGTGAACTCGAGTTCACGAATTTGCAACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-260s1c1
Sequence:CCGGCTGAGGCTCATGGATCACTCTCTCGAGAGAGTGATCCATGAGCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-366s1c1
Sequence:CCGGCCGAGAGAACTGGATTGCGTACTCGAGTACGCAATCCAGTTCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152350.3-416s21c1
Sequence:CCGGCCGAGAGAACTGGATTGCGTACTCGAGTACGCAATCCAGTTCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152350.3-640s21c1
Sequence:CCGGGCCATCAGTTTGGATTCTGAACTCGAGTTCAGAATCCAAACTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152350.3-468s21c1
Sequence:CCGGACGAGGTTGCAAATTCGTGAACTCGAGTTCACGAATTTGCAACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152350.3-485s21c1
Sequence:CCGGTGAAGAATCAGCATCATGTTTCTCGAGAAACATGATGCTGATTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152350
C17orf76-AS1 MISSION shRNA shRNA Plasmid DNA
C17orf76 antisense RNA 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152350.1-590s1c1
Sequence:CCGGGCCATCAGTTTGGATTCTGAACTCGAGTTCAGAATCCAAACTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-435s1c1
Sequence:CCGGTGAAGAATCAGCATCATGTTTCTCGAGAAACATGATGCTGATTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-418s1c1
Sequence:CCGGACGAGGTTGCAAATTCGTGAACTCGAGTTCACGAATTTGCAACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-260s1c1
Sequence:CCGGCTGAGGCTCATGGATCACTCTCTCGAGAGAGTGATCCATGAGCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-366s1c1
Sequence:CCGGCCGAGAGAACTGGATTGCGTACTCGAGTACGCAATCCAGTTCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152350.3-416s21c1
Sequence:CCGGCCGAGAGAACTGGATTGCGTACTCGAGTACGCAATCCAGTTCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152350.3-640s21c1
Sequence:CCGGGCCATCAGTTTGGATTCTGAACTCGAGTTCAGAATCCAAACTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152350.3-468s21c1
Sequence:CCGGACGAGGTTGCAAATTCGTGAACTCGAGTTCACGAATTTGCAACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152350.3-485s21c1
Sequence:CCGGTGAAGAATCAGCATCATGTTTCTCGAGAAACATGATGCTGATTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152350
C17orf76-AS1 MISSION shRNA Lentiviral Transduction Particles
C17orf76 antisense RNA 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152350.1-590s1c1
Sequence:CCGGGCCATCAGTTTGGATTCTGAACTCGAGTTCAGAATCCAAACTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-435s1c1
Sequence:CCGGTGAAGAATCAGCATCATGTTTCTCGAGAAACATGATGCTGATTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-418s1c1
Sequence:CCGGACGAGGTTGCAAATTCGTGAACTCGAGTTCACGAATTTGCAACCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-260s1c1
Sequence:CCGGCTGAGGCTCATGGATCACTCTCTCGAGAGAGTGATCCATGAGCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152350.1-366s1c1
Sequence:CCGGCCGAGAGAACTGGATTGCGTACTCGAGTACGCAATCCAGTTCTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152350.3-416s21c1
Sequence:CCGGCCGAGAGAACTGGATTGCGTACTCGAGTACGCAATCCAGTTCTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152350.3-640s21c1
Sequence:CCGGGCCATCAGTTTGGATTCTGAACTCGAGTTCAGAATCCAAACTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152350.3-468s21c1
Sequence:CCGGACGAGGTTGCAAATTCGTGAACTCGAGTTCACGAATTTGCAACCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152350.3-485s21c1
Sequence:CCGGTGAAGAATCAGCATCATGTTTCTCGAGAAACATGATGCTGATTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)