EMAIL THIS PAGE TO A FRIEND

C18orf56

chromosome 18 open reading frame 56

20 Gene Product Result for
Species: Human C18orf56(494514)
UniProtKB ID: Q8TAI1, A8K1S1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012716 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012716 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138164 predicted 225
2 SASI_Hs01_00138166 predicted 195
3 SASI_Hs01_00138167 predicted 198
4 SASI_Hs01_00138168 predicted 199
5 SASI_Hs01_00138169 predicted 221
6 SASI_Hs01_00138170 predicted 314
7 SASI_Hs01_00138171 predicted 218
8 SASI_Hs01_00138172 predicted 268
9 SASI_Hs01_00138173 predicted 270
10 SASI_Hs02_00306222 predicted 233
11 SASI_Hs01_00138165 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012716
C18orf56 MISSION shRNA Bacterial Glycerol Stock
chromosome 18 open reading frame 56
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012716.1-279s1c1
Sequence:CCGGCAGGATTGAGGTTAGGACTAACTCGAGTTAGTCCTAACCTCAATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-217s21c1
Sequence:CCGGCCTAATGGGACCCTCCGTTTCCTCGAGGAAACGGAGGGTCCCATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-244s21c1
Sequence:CCGGTGTAAGGCGAGGAGGACGATGCTCGAGCATCGTCCTCCTCGCCTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-228s21c1
Sequence:CCGGCCTCCGTTTCGGCGTCTGTAACTCGAGTTACAGACGCCGAAACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012716.1-614s21c1
Sequence:CCGGACTCACAGACTCAGTGTATTTCTCGAGAAATACACTGAGTCTGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-280s21c1
Sequence:CCGGAGGATTGAGGTTAGGACTAAACTCGAGTTTAGTCCTAACCTCAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012716
C18orf56 MISSION shRNA shRNA Plasmid DNA
chromosome 18 open reading frame 56
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012716.1-279s1c1
Sequence:CCGGCAGGATTGAGGTTAGGACTAACTCGAGTTAGTCCTAACCTCAATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-217s21c1
Sequence:CCGGCCTAATGGGACCCTCCGTTTCCTCGAGGAAACGGAGGGTCCCATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-244s21c1
Sequence:CCGGTGTAAGGCGAGGAGGACGATGCTCGAGCATCGTCCTCCTCGCCTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-228s21c1
Sequence:CCGGCCTCCGTTTCGGCGTCTGTAACTCGAGTTACAGACGCCGAAACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012716.1-614s21c1
Sequence:CCGGACTCACAGACTCAGTGTATTTCTCGAGAAATACACTGAGTCTGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-280s21c1
Sequence:CCGGAGGATTGAGGTTAGGACTAAACTCGAGTTTAGTCCTAACCTCAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012716
C18orf56 MISSION shRNA Lentiviral Transduction Particles
chromosome 18 open reading frame 56
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012716.1-279s1c1
Sequence:CCGGCAGGATTGAGGTTAGGACTAACTCGAGTTAGTCCTAACCTCAATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-217s21c1
Sequence:CCGGCCTAATGGGACCCTCCGTTTCCTCGAGGAAACGGAGGGTCCCATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-244s21c1
Sequence:CCGGTGTAAGGCGAGGAGGACGATGCTCGAGCATCGTCCTCCTCGCCTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-228s21c1
Sequence:CCGGCCTCCGTTTCGGCGTCTGTAACTCGAGTTACAGACGCCGAAACGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012716.1-614s21c1
Sequence:CCGGACTCACAGACTCAGTGTATTTCTCGAGAAATACACTGAGTCTGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012716.1-280s21c1
Sequence:CCGGAGGATTGAGGTTAGGACTAAACTCGAGTTTAGTCCTAACCTCAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)