EMAIL THIS PAGE TO A FRIEND

C1orf198

chromosome 1 open reading frame 198

30 Gene Product Result for
UniProtKB ID: Q9H425, A8K8R8, B3KTW1, G5EA08
Gene ID:
chicken(768787) chromosome 3 open reading frame, human C1orf198
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA004798 Anti-C1orf198 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032800 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091711 MISSION® esiRNA esiRNA human C1orf198 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032800 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225175 predicted 578
2 SASI_Hs01_00225176 predicted 1416
3 SASI_Hs01_00225177 predicted 1301
4 SASI_Hs01_00225179 predicted 320
5 SASI_Hs01_00225180 predicted 400
6 SASI_Hs01_00225181 predicted 1309
7 SASI_Hs02_00360360 predicted 1091
8 SASI_Hs02_00360361 predicted 389
9 SASI_Hs01_00225182 predicted 417
10 SASI_Hs01_00225183 predicted 103
11 SASI_Hs01_00225178 predicted 1320
12 SASI_Hs01_00225184 predicted 1195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032800
VALIDATED
C1orf198 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 198
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032800.1-952s1c1
Sequence:CCGGCTCAAGTAATGTCGTCTTGAACTCGAGTTCAAGACGACATTACTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032800.1-106s1c1
Sequence:CCGGCTTCACTTACTTCTCGTCGCTCTCGAGAGCGACGAGAAGTAAGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032800.1-941s1c1
Sequence:CCGGGCACAGGTCAGCTCAAGTAATCTCGAGATTACTTGAGCTGACCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032800.1-347s1c1
Sequence:CCGGGACGAGGATCTAACTTGGCAACTCGAGTTGCCAAGTTAGATCCTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032800.1-390s1c1
Sequence:CCGGCCTGGGAAACAAAGAGTCAGACTCGAGTCTGACTCTTTGTTTCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032800.1-964s1c1
Sequence:CCGGCGTCTTGAAGACGGGATTTGACTCGAGTCAAATCCCGTCTTCAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032800.1-1302s1c1
Sequence:CCGGCCCTCCTCAAAGGATGTGTTTCTCGAGAAACACATCCTTTGAGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032800.1-139s1c1
Sequence:CCGGCAGGAAGATCATGCAGGACAACTCGAGTTGTCCTGCATGATCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032800.1-949s1c1
Sequence:CCGGCAGCTCAAGTAATGTCGTCTTCTCGAGAAGACGACATTACTTGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032800
VALIDATED
C1orf198 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 198
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032800.1-952s1c1
Sequence:CCGGCTCAAGTAATGTCGTCTTGAACTCGAGTTCAAGACGACATTACTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032800.1-106s1c1
Sequence:CCGGCTTCACTTACTTCTCGTCGCTCTCGAGAGCGACGAGAAGTAAGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032800.1-941s1c1
Sequence:CCGGGCACAGGTCAGCTCAAGTAATCTCGAGATTACTTGAGCTGACCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032800.1-347s1c1
Sequence:CCGGGACGAGGATCTAACTTGGCAACTCGAGTTGCCAAGTTAGATCCTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032800.1-390s1c1
Sequence:CCGGCCTGGGAAACAAAGAGTCAGACTCGAGTCTGACTCTTTGTTTCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032800.1-964s1c1
Sequence:CCGGCGTCTTGAAGACGGGATTTGACTCGAGTCAAATCCCGTCTTCAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032800.1-1302s1c1
Sequence:CCGGCCCTCCTCAAAGGATGTGTTTCTCGAGAAACACATCCTTTGAGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032800.1-139s1c1
Sequence:CCGGCAGGAAGATCATGCAGGACAACTCGAGTTGTCCTGCATGATCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032800.1-949s1c1
Sequence:CCGGCAGCTCAAGTAATGTCGTCTTCTCGAGAAGACGACATTACTTGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032800
VALIDATED
C1orf198 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 198
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032800.1-952s1c1
Sequence:CCGGCTCAAGTAATGTCGTCTTGAACTCGAGTTCAAGACGACATTACTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032800.1-106s1c1
Sequence:CCGGCTTCACTTACTTCTCGTCGCTCTCGAGAGCGACGAGAAGTAAGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032800.1-941s1c1
Sequence:CCGGGCACAGGTCAGCTCAAGTAATCTCGAGATTACTTGAGCTGACCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032800.1-347s1c1
Sequence:CCGGGACGAGGATCTAACTTGGCAACTCGAGTTGCCAAGTTAGATCCTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032800.1-390s1c1
Sequence:CCGGCCTGGGAAACAAAGAGTCAGACTCGAGTCTGACTCTTTGTTTCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032800.1-964s1c1
Sequence:CCGGCGTCTTGAAGACGGGATTTGACTCGAGTCAAATCCCGTCTTCAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032800.1-1302s1c1
Sequence:CCGGCCCTCCTCAAAGGATGTGTTTCTCGAGAAACACATCCTTTGAGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032800.1-139s1c1
Sequence:CCGGCAGGAAGATCATGCAGGACAACTCGAGTTGTCCTGCATGATCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032800.1-949s1c1
Sequence:CCGGCAGCTCAAGTAATGTCGTCTTCTCGAGAAGACGACATTACTTGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)